Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0254 Transporter Info
Gene Name SLC2A12
Transporter Name Glucose transporter type 12
Gene ID
154091
UniProt ID
Q8TD20
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 TSS1500 (cg03039701)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 5.70E-07; Z-score: -6.52E+00

Methylation in Case

 4.18E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 TSS1500 (cg09563617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.05E-03; Z-score: -1.25E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg20949198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.55E+00 Statistic Test p-value: 2.43E-09; Z-score: -8.36E+00

Methylation in Case

 3.19E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg11381149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 1.56E-04; Z-score: 3.84E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.15E-04; Z-score: -2.73E+00

Methylation in Case

 8.25E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.66E-04; Z-score: -6.71E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg08448341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.44E-03; Z-score: -1.48E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A12 in bladder cancer [ 1 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.90E-02; Z-score: -1.66E+00

Methylation in Case

 6.67E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 TSS1500 (cg09563617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.60E-05; Z-score: -8.81E-01

Methylation in Case

 8.57E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 TSS1500 (cg11599694)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.33E-02; Z-score: -6.62E-01

Methylation in Case

 8.67E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 TSS200 (cg26808921)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 5.97E-06; Z-score: 1.16E+00

Methylation in Case

 6.29E-02 (Median) Methylation in Control 4.79E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 TSS200 (cg04230910)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.81E-02; Z-score: 3.58E-02

Methylation in Case

 7.04E-02 (Median) Methylation in Control 6.97E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 9.31E-14; Z-score: 1.84E+00

Methylation in Case

 8.34E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg20949198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.14E-04; Z-score: -2.03E-01

Methylation in Case

 8.19E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg08448341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.92E-04; Z-score: -7.74E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 6.85E-04; Z-score: -5.53E-01

Methylation in Case

 7.56E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.05E-03; Z-score: -8.20E-01

Methylation in Case

 7.31E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC2A12 in breast cancer [ 2 ]

Location

 Body (cg05888385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.15E-02; Z-score: -2.12E-01

Methylation in Case

 8.85E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg03039701)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.27E-02; Z-score: -6.53E-01

Methylation in Case

 7.00E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg09563617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.68E-02; Z-score: -4.21E-01

Methylation in Case

 9.35E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 Body (cg20949198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 6.19E-07; Z-score: -1.88E+00

Methylation in Case

 8.40E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.09E-05; Z-score: -1.23E+00

Methylation in Case

 9.33E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 Body (cg13349179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.11E-02; Z-score: 5.95E-01

Methylation in Case

 1.43E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in colorectal cancer [ 3 ]

Location

 3'UTR (cg09143641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.36E-02; Z-score: -4.19E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in depression [ 4 ]

Location

 TSS1500 (cg09563617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.11E-03; Z-score: 7.56E-01

Methylation in Case

 7.84E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg03039701)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 4.70E-08; Z-score: -2.49E+00

Methylation in Case

 6.25E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg12052661)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 1.29E-20; Z-score: 3.68E+00

Methylation in Case

 5.25E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.65E-04; Z-score: -1.23E+00

Methylation in Case

 8.27E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg20949198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 5.15E-03; Z-score: 8.31E-01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg13349179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 8.35E-03; Z-score: -5.59E-01

Methylation in Case

 9.30E-02 (Median) Methylation in Control 9.90E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.60E-03; Z-score: -3.96E-01

Methylation in Case

 6.95E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg05888385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.07E-02; Z-score: -3.35E-01

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A12 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.76E-02; Z-score: -3.04E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg05331214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.83E-05; Z-score: -1.03E+00

Methylation in Case

 6.72E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS200 (cg26450866)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.67E-02; Z-score: -1.35E-01

Methylation in Case

 2.53E-01 (Median) Methylation in Control 2.58E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg26607031)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 4.76E-10; Z-score: 1.80E+00

Methylation in Case

 5.58E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg25232795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 7.50E-08; Z-score: -1.73E+00

Methylation in Case

 6.78E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg13688474)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.18E-05; Z-score: -1.56E+00

Methylation in Case

 2.19E-01 (Median) Methylation in Control 3.49E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg07617129)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.18E-05; Z-score: 1.22E+00

Methylation in Case

 8.46E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg17522727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 3.27E-05; Z-score: 1.31E+00

Methylation in Case

 7.71E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg03406993)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.09E-03; Z-score: 9.77E-01

Methylation in Case

 8.90E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg00071051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 7.06E-03; Z-score: 7.50E-01

Methylation in Case

 4.39E-01 (Median) Methylation in Control 3.95E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC2A12 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg06048662)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.18E-02; Z-score: 8.08E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in HIV infection [ 7 ]

Location

 TSS200 (cg26808921)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 2.27E-04; Z-score: 1.02E+00

Methylation in Case

 7.75E-02 (Median) Methylation in Control 6.33E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in HIV infection [ 7 ]

Location

 TSS200 (cg04230910)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.24E-02; Z-score: 4.31E-01

Methylation in Case

 7.97E-02 (Median) Methylation in Control 7.40E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in HIV infection [ 7 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 6.91E-14; Z-score: 1.71E+00

Methylation in Case

 8.71E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in HIV infection [ 7 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.46E-03; Z-score: -6.59E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in lung adenocarcinoma [ 8 ]

Location

 TSS200 (cg26808921)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 2.11E-03; Z-score: 2.51E+00

Methylation in Case

 9.65E-02 (Median) Methylation in Control 7.82E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in lung adenocarcinoma [ 8 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.84E-04; Z-score: 2.16E+00

Methylation in Case

 7.90E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in panic disorder [ 9 ]

Location

 TSS200 (cg05943335)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.67E-01 Statistic Test p-value: 1.88E-02; Z-score: 3.95E-01

Methylation in Case

 -3.61E+00 (Median) Methylation in Control -3.73E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg05888385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.78E-03; Z-score: -8.63E-01

Methylation in Case

 7.89E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.70E-03; Z-score: -5.14E-01

Methylation in Case

 6.43E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg07223937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 3.71E-03; Z-score: 5.07E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg08448341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 6.44E-03; Z-score: -5.43E-01

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg11381149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 2.20E-02; Z-score: -9.30E-01

Methylation in Case

 1.83E-01 (Median) Methylation in Control 3.03E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.79E-02; Z-score: 6.03E-01

Methylation in Case

 8.74E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg13349179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.42E-02; Z-score: 4.05E-01

Methylation in Case

 9.06E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A12 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 3'UTR (cg09143641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.62E+00 Statistic Test p-value: 9.19E-13; Z-score: -2.08E+00

Methylation in Case

 3.13E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in papillary thyroid cancer [ 11 ]

Location

 Body (cg12486558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.24E-04; Z-score: 9.30E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in papillary thyroid cancer [ 11 ]

Location

 Body (cg20949198)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.09E-03; Z-score: -5.35E-01

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A12 in papillary thyroid cancer [ 11 ]

Location

 Body (cg11381149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.43E-03; Z-score: 6.24E-01

Methylation in Case

 9.20E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A12 in papillary thyroid cancer [ 11 ]

Location

 Body (cg13349179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.43E-02; Z-score: 6.08E-01

Methylation in Case

 9.11E-02 (Median) Methylation in Control 8.60E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A12 in papillary thyroid cancer [ 11 ]

Location

 Body (cg06628901)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.26E-02; Z-score: 1.43E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in prostate cancer [ 12 ]

Location

 Body (cg23530596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.60E+00 Statistic Test p-value: 1.09E-02; Z-score: 7.18E+00

Methylation in Case

 7.21E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A12 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg11381149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.20E-02; Z-score: -1.73E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A12 in systemic lupus erythematosus [ 13 ]

Location

 3'UTR (cg09143641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.51E-02; Z-score: -1.41E-01

Methylation in Case

 9.25E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1277 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

 AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 2

 miR-147a directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-147a miRNA Mature ID miR-147a

miRNA Sequence

 GUGUGUGGAAAUGCUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 3

 miR-190a directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 4

 miR-2113 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2113 miRNA Mature ID miR-2113

miRNA Sequence

 AUUUGUGCUUGGCUCUGUCAC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 5

 miR-223 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-223 miRNA Mature ID miR-223-5p

miRNA Sequence

 CGUGUAUUUGACAAGCUGAGUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 6

 miR-335 directly targets SLC2A12 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-501 directly targets SLC2A12 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-501 miRNA Mature ID miR-501-3p

miRNA Sequence

 AAUGCACCCGGGCAAGGAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-5010 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5010 miRNA Mature ID miR-5010-3p

miRNA Sequence

 UUUUGUGUCUCCCAUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 9

 miR-5011 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 10

 miR-502 directly targets SLC2A12 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-502 miRNA Mature ID miR-502-3p

miRNA Sequence

 AAUGCACCUGGGCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-574 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-574 miRNA Mature ID miR-574-5p

miRNA Sequence

 UGAGUGUGUGUGUGUGAGUGUGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 12

 miR-6818 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6818 miRNA Mature ID miR-6818-5p

miRNA Sequence

 UUGUGUGAGUACAGAGAGCAUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 13

 miR-6867 directly targets SLC2A12 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6867 miRNA Mature ID miR-6867-5p

miRNA Sequence

 UGUGUGUGUAGAGGAAGAAGGGA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 14

 miR-767 directly targets SLC2A12 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

 UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
15 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.