Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0255 Transporter Info
Gene Name SLC2A13
Transporter Name Proton myo-inositol cotransporter
Gene ID
114134
UniProt ID
Q96QE2
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg02634414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.82E-04; Z-score: 6.97E-01

Methylation in Case

 3.93E-01 (Median) Methylation in Control 3.19E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg15141217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.52E-02; Z-score: 7.41E-01

Methylation in Case

 7.10E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg27320127)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 7.05E-12; Z-score: 1.97E+00

Methylation in Case

 3.26E-01 (Median) Methylation in Control 2.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg19698309)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.62E-02; Z-score: -6.73E-01

Methylation in Case

 6.59E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg07788437)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.84E-05; Z-score: 1.34E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg24333621)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.24E-03; Z-score: -6.68E-01

Methylation in Case

 8.31E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg24850535)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.41E-03; Z-score: -1.05E+00

Methylation in Case

 3.35E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg03479705)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.62E-03; Z-score: -3.73E-01

Methylation in Case

 4.02E-01 (Median) Methylation in Control 4.20E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC2A13 in pancretic ductal adenocarcinoma [ 1 ]

Location

 3'UTR (cg20558112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.71E-04; Z-score: 1.29E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.72E+00 Statistic Test p-value: 4.48E-09; Z-score: -7.53E+00

Methylation in Case

 4.22E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 TSS1500 (cg01603095)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 6.33E-03; Z-score: -3.46E+00

Methylation in Case

 1.51E-01 (Median) Methylation in Control 2.56E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 TSS1500 (cg16219968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.06E-02; Z-score: -6.07E-01

Methylation in Case

 4.54E-02 (Median) Methylation in Control 4.80E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg05770947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 3.39E-08; Z-score: -1.30E+01

Methylation in Case

 6.86E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg21803141)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 4.09E-08; Z-score: -6.47E+00

Methylation in Case

 4.90E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 5.90E-08; Z-score: -1.11E+01

Methylation in Case

 7.34E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg14678680)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 2.18E-06; Z-score: -1.12E+01

Methylation in Case

 6.95E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg02641941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.20E+00 Statistic Test p-value: 2.63E-06; Z-score: -5.74E+00

Methylation in Case

 2.79E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg16190510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.41E+00 Statistic Test p-value: 1.53E-05; Z-score: -5.09E+00

Methylation in Case

 2.12E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg23680411)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.22E-03; Z-score: -2.33E+00

Methylation in Case

 8.57E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg07287345)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.19E-03; Z-score: -1.48E+00

Methylation in Case

 8.88E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC2A13 in bladder cancer [ 2 ]

Location

 Body (cg04626413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.10E-02; Z-score: -2.30E+00

Methylation in Case

 8.91E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 TSS1500 (cg01603095)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.52E+00 Statistic Test p-value: 1.71E-09; Z-score: 2.62E+00

Methylation in Case

 3.13E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 8.21E-03; Z-score: 1.51E+00

Methylation in Case

 6.55E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 9.05E-12; Z-score: -2.14E+00

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg14678680)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.46E-06; Z-score: 1.52E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg21803141)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.47E-04; Z-score: -8.99E-01

Methylation in Case

 5.88E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg05770947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.45E-03; Z-score: -4.33E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg07287345)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.42E-03; Z-score: -6.78E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg02641941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 6.63E-03; Z-score: 4.40E-01

Methylation in Case

 7.61E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC2A13 in breast cancer [ 3 ]

Location

 Body (cg00790847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.40E-03; Z-score: -6.31E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.79E-03; Z-score: -1.56E+00

Methylation in Case

 9.08E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg01603095)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.38E-02; Z-score: 9.37E-01

Methylation in Case

 3.23E-01 (Median) Methylation in Control 2.76E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg16219968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.26E-02; Z-score: -2.53E-01

Methylation in Case

 1.59E-02 (Median) Methylation in Control 1.68E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 7.65E-10; Z-score: -2.35E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 1stExon (cg04575343)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.06E-02; Z-score: 3.97E-01

Methylation in Case

 8.21E-02 (Median) Methylation in Control 7.79E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg05770947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.38E-06; Z-score: -1.23E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg00790847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.20E-05; Z-score: 1.42E+00

Methylation in Case

 9.30E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg21803141)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.90E-05; Z-score: -1.42E+00

Methylation in Case

 6.80E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg02641941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.92E-02; Z-score: 9.64E-01

Methylation in Case

 6.40E-01 (Median) Methylation in Control 5.31E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg18785532)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.01E-02; Z-score: 6.23E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC2A13 in colorectal cancer [ 5 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.57E-02; Z-score: -5.80E-01

Methylation in Case

 9.12E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg02371464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.86E+00 Statistic Test p-value: 1.10E-12; Z-score: 4.74E+00

Methylation in Case

 3.82E-01 (Median) Methylation in Control 2.05E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg01603095)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 3.41E-04; Z-score: -7.89E-01

Methylation in Case

 2.82E-01 (Median) Methylation in Control 3.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.42E-04; Z-score: -3.86E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.96E-07; Z-score: -1.02E+00

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg02641941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.66E-05; Z-score: 1.01E+00

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.19E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg05770947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.06E-04; Z-score: -8.95E-01

Methylation in Case

 6.82E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A13 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg16190510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.98E-02; Z-score: -4.72E-01

Methylation in Case

 6.47E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg01603095)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 3.71E-04; Z-score: 2.53E+00

Methylation in Case

 4.51E-01 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in lung adenocarcinoma [ 7 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.37E-04; Z-score: -2.65E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in lung adenocarcinoma [ 7 ]

Location

 Body (cg16190510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.15E-02; Z-score: 1.79E+00

Methylation in Case

 7.63E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in panic disorder [ 8 ]

Location

 TSS1500 (cg05581394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 7.09E-03; Z-score: 5.11E-01

Methylation in Case

 2.79E+00 (Median) Methylation in Control 2.67E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in panic disorder [ 8 ]

Location

 Body (cg04626413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.34E+00 Statistic Test p-value: 1.15E-08; Z-score: -1.16E+00

Methylation in Case

 3.78E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in panic disorder [ 8 ]

Location

 Body (cg00790847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 9.68E-03; Z-score: 6.35E-01

Methylation in Case

 2.83E+00 (Median) Methylation in Control 2.68E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg16219968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 4.77E-04; Z-score: -1.43E+00

Methylation in Case

 5.60E-02 (Median) Methylation in Control 7.91E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg25307593)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 1.89E-05; Z-score: -5.48E-01

Methylation in Case

 4.24E-02 (Median) Methylation in Control 5.15E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in papillary thyroid cancer [ 9 ]

Location

 Body (cg14061497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.70E-07; Z-score: -8.82E-01

Methylation in Case

 9.35E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A13 in papillary thyroid cancer [ 9 ]

Location

 Body (cg04626413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.72E-03; Z-score: -3.95E-01

Methylation in Case

 9.38E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A13 in papillary thyroid cancer [ 9 ]

Location

 Body (cg02641941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.08E-02; Z-score: -4.10E-01

Methylation in Case

 7.64E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in colon adenocarcinoma [ 10 ]

Location

 Body (cg04804543)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.16E-04; Z-score: -3.52E+00

Methylation in Case

 6.44E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in colon adenocarcinoma [ 10 ]

Location

 Body (cg21491340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.10E-03; Z-score: -4.44E+00

Methylation in Case

 9.21E-01 (Median) Methylation in Control 9.65E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A13 in prostate cancer [ 11 ]

Location

 Body (cg15999077)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.74E-02; Z-score: -2.25E+00

Methylation in Case

 6.48E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A13 in prostate cancer [ 11 ]

Location

 Body (cg15089806)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 3.16E-02; Z-score: 1.58E+00

Methylation in Case

 8.52E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A13 in prostate cancer [ 11 ]

Location

 3'UTR (cg17442852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 9.19E-04; Z-score: 3.95E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1207 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1207 miRNA Mature ID miR-1207-5p

miRNA Sequence

 UGGCAGGGAGGCUGGGAGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1910 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1910 miRNA Mature ID miR-1910-3p

miRNA Sequence

 GAGGCAGAAGCAGGAUGACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-2682 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2682 miRNA Mature ID miR-2682-5p

miRNA Sequence

 CAGGCAGUGACUGUUCAGACGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-335 directly targets SLC2A13 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-34b directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-34b miRNA Mature ID miR-34b-5p

miRNA Sequence

 UAGGCAGUGUCAUUAGCUGAUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-381 directly targets SLC2A13 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

 UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 miR-4270 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

 UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4441 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

 ACAGGGAGGAGAUUGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-449c directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-449c miRNA Mature ID miR-449c-5p

miRNA Sequence

 UAGGCAGUGUAUUGCUAGCGGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4705 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4705 miRNA Mature ID miR-4705

miRNA Sequence

 UCAAUCACUUGGUAAUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4763 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4763 miRNA Mature ID miR-4763-3p

miRNA Sequence

 AGGCAGGGGCUGGUGCUGGGCGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-6511a directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6511a miRNA Mature ID miR-6511a-5p

miRNA Sequence

 CAGGCAGAAGUGGGGCUGACAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-6754 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

 CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6808 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

 CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-6826 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6826 miRNA Mature ID miR-6826-5p

miRNA Sequence

 UCAAUAGGAAAGAGGUGGGACCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-6893 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

 CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-940 directly targets SLC2A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-940 miRNA Mature ID miR-940

miRNA Sequence

 AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
14 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.