Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0256 Transporter Info
Gene Name	SLC2A14
Transporter Name	Glucose transporter type 14
Gene ID	144195
UniProt ID	Q8TDB8

Epigenetic Regulations of This DT (EGR)
Methylation
Acute lymphoblastic leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC2A14 in acute lymphoblastic leukemia			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC2A14	Experiment Method	RT-qPCR
Studied Phenotype	Acute lymphoblastic leukemia [ ICD-11: 2B33.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.22E+00	Statistic Test	p-value: 6.62E-08; Z-score: 1.48E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	5.31E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 1.99E-06; Z-score: -1.17E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	2.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg25020919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 8.85E-06; Z-score: 1.10E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	6.84E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg09592224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.13E-02; Z-score: 3.21E-01
Methylation in Case	9.18E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg12970757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 3.22E-02; Z-score: -8.66E-02
Methylation in Case	7.48E-02 (Median)	Methylation in Control	8.32E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	3'UTR (cg10097316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.09E-12; Z-score: -2.54E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	5'UTR (cg25020919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.92E+00	Statistic Test	p-value: 2.84E-12; Z-score: -2.62E+01
Methylation in Case	4.40E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.60E+00	Statistic Test	p-value: 3.47E-10; Z-score: 8.56E+00
Methylation in Case	6.89E-01 (Median)	Methylation in Control	2.65E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 5.48E-07; Z-score: -1.63E+01
Methylation in Case	6.16E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 8.21E-06; Z-score: -6.48E+00
Methylation in Case	6.56E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 2.11E-05; Z-score: 4.78E+00
Methylation in Case	7.71E-01 (Median)	Methylation in Control	5.45E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg06122660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.89E+00	Statistic Test	p-value: 9.22E-14; Z-score: 1.33E+01
Methylation in Case	4.43E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.03E+00	Statistic Test	p-value: 1.28E-13; Z-score: 1.49E+01
Methylation in Case	6.39E-01 (Median)	Methylation in Control	3.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.67E+00	Statistic Test	p-value: 3.73E-13; Z-score: 1.22E+01
Methylation in Case	6.41E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg16404371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.01E+00	Statistic Test	p-value: 2.10E-10; Z-score: 1.02E+01
Methylation in Case	5.25E-01 (Median)	Methylation in Control	8.73E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg13323752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.57E+00	Statistic Test	p-value: 4.93E-07; Z-score: 6.07E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.64E+00	Statistic Test	p-value: 2.84E-05; Z-score: 4.49E+00
Methylation in Case	3.75E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	Body (cg16496592)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 6.71E-09; Z-score: 8.13E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	6.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	Body (cg12970757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 4.28E-04; Z-score: 2.99E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC2A14 in bladder cancer			[ 3 ]
Location	3'UTR (cg10097316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 3.82E-11; Z-score: -1.32E+01
Methylation in Case	5.29E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.66E+00	Statistic Test	p-value: 9.91E-11; Z-score: 1.53E+00
Methylation in Case	3.33E-01 (Median)	Methylation in Control	2.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 5.69E-10; Z-score: -2.15E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	5'UTR (cg25020919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 7.15E-07; Z-score: -1.13E+00
Methylation in Case	7.45E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.65E-13; Z-score: -2.62E+00
Methylation in Case	8.13E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.63E-10; Z-score: 1.32E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.60E+00	Statistic Test	p-value: 2.07E-22; Z-score: 3.66E+00
Methylation in Case	4.83E-01 (Median)	Methylation in Control	1.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg06122660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.36E+00	Statistic Test	p-value: 3.18E-21; Z-score: 3.40E+00
Methylation in Case	3.16E-01 (Median)	Methylation in Control	1.34E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg16404371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.47E+00	Statistic Test	p-value: 1.02E-19; Z-score: 5.89E+00
Methylation in Case	3.79E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.73E+00	Statistic Test	p-value: 1.03E-18; Z-score: 3.64E+00
Methylation in Case	3.50E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 1.38E-16; Z-score: 2.67E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	3.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	TSS200 (cg13323752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.99E+00	Statistic Test	p-value: 1.71E-14; Z-score: 3.98E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	8.10E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	Body (cg12970757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 7.04E-05; Z-score: -1.04E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	Body (cg09592224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.88E-02; Z-score: -4.44E-01
Methylation in Case	7.21E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC2A14 in breast cancer			[ 4 ]
Location	3'UTR (cg10097316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.75E-03; Z-score: -5.35E-01
Methylation in Case	7.39E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in celiac disease			[ 5 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 4.31E-02; Z-score: 6.90E-01
Methylation in Case	2.68E-01 (Median)	Methylation in Control	1.90E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Renal cell carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 5.11E-08; Z-score: 1.75E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.21E-06; Z-score: -3.94E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	9.66E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 1.14E-10; Z-score: 1.99E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.11E-03; Z-score: -7.83E-01
Methylation in Case	9.51E-01 (Median)	Methylation in Control	9.64E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 9.23E-06; Z-score: 1.53E+00
Methylation in Case	3.57E-01 (Median)	Methylation in Control	2.76E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg06122660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 9.38E-06; Z-score: 1.96E+00
Methylation in Case	2.55E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.78E+00	Statistic Test	p-value: 1.09E-05; Z-score: 1.68E+00
Methylation in Case	2.74E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg16404371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.68E+00	Statistic Test	p-value: 1.92E-05; Z-score: 7.14E-01
Methylation in Case	8.58E-02 (Median)	Methylation in Control	5.10E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 1.75E-03; Z-score: 7.24E-01
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg13323752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 1.81E-03; Z-score: 3.29E-01
Methylation in Case	4.65E-02 (Median)	Methylation in Control	3.42E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	5'UTR (cg13774987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.47E-06; Z-score: 1.53E+00
Methylation in Case	8.07E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.52E+00	Statistic Test	p-value: 6.86E-06; Z-score: 2.52E+00
Methylation in Case	5.02E-01 (Median)	Methylation in Control	3.30E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	5'UTR (cg20018106)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.02E-04; Z-score: -2.27E+00
Methylation in Case	5.93E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg00161955)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.19E-05; Z-score: -3.56E+00
Methylation in Case	6.42E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg26590082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 3.13E-04; Z-score: 1.47E+00
Methylation in Case	4.65E-01 (Median)	Methylation in Control	3.87E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	TSS200 (cg23752563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 7.63E-06; Z-score: 2.62E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	3.09E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	TSS200 (cg18314695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.22E-04; Z-score: -2.96E+00
Methylation in Case	6.79E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	Body (cg24069602)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.02E-08; Z-score: -2.83E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	5.99E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	Body (cg14055896)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 3.22E-07; Z-score: 2.07E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	4.05E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in colon adenocarcinoma			[ 7 ]
Location	Body (cg19503341)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 6.86E-06; Z-score: -3.02E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	5.08E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.79E-07; Z-score: -3.63E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	5'UTR (cg25020919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.20E-03; Z-score: -7.11E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.97E-07; Z-score: -2.90E+00
Methylation in Case	8.37E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS200 (cg06122660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.41E-05; Z-score: 1.08E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.96E-04; Z-score: 7.06E-01
Methylation in Case	6.11E-01 (Median)	Methylation in Control	5.08E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 7.63E-04; Z-score: 6.70E-01
Methylation in Case	4.69E-01 (Median)	Methylation in Control	3.98E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS200 (cg13323752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 1.31E-02; Z-score: 4.97E-01
Methylation in Case	4.34E-01 (Median)	Methylation in Control	3.80E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.39E-02; Z-score: 6.75E-01
Methylation in Case	6.73E-01 (Median)	Methylation in Control	5.75E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in colorectal cancer			[ 8 ]
Location	3'UTR (cg10097316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.75E-07; Z-score: -1.73E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg00308503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 7.09E-12; Z-score: -3.03E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	6.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.75E-05; Z-score: -9.94E-01
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	5'UTR (cg25020919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.31E-03; Z-score: -4.36E-01
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 7.64E-08; Z-score: 1.80E+00
Methylation in Case	7.56E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.33E-03; Z-score: -6.14E-01
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg02576220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 1.13E-21; Z-score: -1.99E+01
Methylation in Case	6.26E-01 (Median)	Methylation in Control	9.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg11306735)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 1.13E-13; Z-score: -2.96E+00
Methylation in Case	4.16E-01 (Median)	Methylation in Control	5.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg19221303)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 8.11E-11; Z-score: -3.14E+00
Methylation in Case	6.94E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg24701309)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 9.12E-10; Z-score: -3.06E+00
Methylation in Case	6.64E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg16496592)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.37E-02; Z-score: -2.67E-01
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.73E-05; Z-score: -7.83E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 5.79E-03; Z-score: 8.45E-01
Methylation in Case	1.92E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	TSS1500 (cg07931785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 8.83E-03; Z-score: -1.00E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.71E-03; Z-score: 9.09E-01
Methylation in Case	3.16E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.66E+00	Statistic Test	p-value: 3.81E-03; Z-score: 8.30E-01
Methylation in Case	1.48E-01 (Median)	Methylation in Control	8.95E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.18E+00	Statistic Test	p-value: 6.02E-03; Z-score: 1.32E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	7.11E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	TSS200 (cg16404371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 2.82E-02; Z-score: 4.31E-01
Methylation in Case	8.65E-02 (Median)	Methylation in Control	6.50E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	Body (cg12970757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.03E-04; Z-score: 7.92E-01
Methylation in Case	6.77E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	Body (cg09592224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.37E-04; Z-score: 1.53E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	Body (cg16496592)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 5.65E-04; Z-score: 6.95E-01
Methylation in Case	7.61E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	Body (cg19016972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 7.37E-04; Z-score: 8.26E-01
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC2A14 in HIV infection			[ 10 ]
Location	3'UTR (cg10097316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.23E-04; Z-score: -1.40E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in lung adenocarcinoma			[ 11 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.66E-02; Z-score: -1.48E+00
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.82E-03; Z-score: 2.08E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg19556774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.85E+00	Statistic Test	p-value: 1.61E-02; Z-score: 1.43E+00
Methylation in Case	3.80E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.78E+00	Statistic Test	p-value: 4.68E-02; Z-score: 1.37E+00
Methylation in Case	4.55E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in lung adenocarcinoma			[ 11 ]
Location	Body (cg09592224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.75E-02; Z-score: -2.01E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in pancretic ductal adenocarcinoma			[ 12 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 3.58E-07; Z-score: 8.19E-01
Methylation in Case	2.38E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg23615676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.03E+00	Statistic Test	p-value: 1.80E-14; Z-score: 2.99E+00
Methylation in Case	3.55E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS1500 (cg04818947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.04E-03; Z-score: 5.35E-01
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg25034117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.71E-02; Z-score: -4.70E-01
Methylation in Case	7.25E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.53E-06; Z-score: -1.36E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	5'UTR (cg06645921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.87E-02; Z-score: 2.33E-01
Methylation in Case	1.91E-01 (Median)	Methylation in Control	1.81E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 2.81E-04; Z-score: 1.39E+00
Methylation in Case	5.29E-01 (Median)	Methylation in Control	4.42E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg15251385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 9.89E-04; Z-score: 6.08E-01
Methylation in Case	1.58E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg16404371)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.31E-02; Z-score: 3.12E-01
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in papillary thyroid cancer			[ 13 ]
Location	Body (cg19016972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.01E-04; Z-score: -9.41E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	5'UTR (cg17566867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.05E-03; Z-score: 3.56E+00
Methylation in Case	8.41E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	TSS1500 (cg17032646)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 4.09E-03; Z-score: 3.89E+00
Methylation in Case	5.16E-01 (Median)	Methylation in Control	3.75E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	TSS1500 (cg17306747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.92E+00	Statistic Test	p-value: 6.69E-03; Z-score: 4.21E+00
Methylation in Case	5.39E-01 (Median)	Methylation in Control	2.81E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	TSS1500 (cg03963113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 9.41E-03; Z-score: -5.48E+00
Methylation in Case	5.84E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	TSS1500 (cg24079038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.53E+00	Statistic Test	p-value: 2.57E-02; Z-score: 5.26E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	3.56E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	TSS200 (cg05534403)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.60E+00	Statistic Test	p-value: 4.92E-03; Z-score: 7.55E+00
Methylation in Case	5.98E-01 (Median)	Methylation in Control	2.30E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	Body (cg05603680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.45E-03; Z-score: 3.65E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	Body (cg27000496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.36E-02; Z-score: 6.39E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	Body (cg08702805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.81E-02; Z-score: 1.81E+00
Methylation in Case	8.86E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A14 in prostate cancer			[ 14 ]
Location	3'UTR (cg07737682)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.29E-02; Z-score: 2.29E+00
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A14 in systemic lupus erythematosus			[ 15 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.62E-02; Z-score: -2.67E-02
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A14 in systemic lupus erythematosus			[ 15 ]
Location	TSS1500 (cg00955780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.13E-03; Z-score: -3.10E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A14 in systemic lupus erythematosus			[ 15 ]
Location	TSS200 (cg13323752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 3.91E-03; Z-score: -2.61E-01
Methylation in Case	7.07E-02 (Median)	Methylation in Control	8.09E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	27 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1182 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1182	miRNA Mature ID	miR-1182
miRNA Sequence	GAGGGUCUUGGGAGGGAUGUGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-143 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-3p
miRNA Sequence	UGAGAUGAAGCACUGUAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-29a directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29a	miRNA Mature ID	miR-29a-3p
miRNA Sequence	UAGCACCAUCUGAAAUCGGUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-29b directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29b	miRNA Mature ID	miR-29b-3p
miRNA Sequence	UAGCACCAUUUGAAAUCAGUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-29c directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29c	miRNA Mature ID	miR-29c-3p
miRNA Sequence	UAGCACCAUUUGAAAUCGGUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-3153 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3153	miRNA Mature ID	miR-3153
miRNA Sequence	GGGGAAAGCGAGUAGGGACAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-3154 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3154	miRNA Mature ID	miR-3154
miRNA Sequence	CAGAAGGGGAGUUGGGAGCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-335 directly targets SLC2A14			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-34a directly targets SLC2A14			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-34a	miRNA Mature ID	miR-34a-5p
miRNA Sequence	UGGCAGUGUCUUAGCUGGUUGU
miRNA Target Type	Direct
Experimental Material	Human colorectal cancer cell line (SW480)
Epigenetic Phenomenon 10	miR-4251 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4251	miRNA Mature ID	miR-4251
miRNA Sequence	CCUGAGAAAAGGGCCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-4329 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4329	miRNA Mature ID	miR-4329
miRNA Sequence	CCUGAGACCCUAGUUCCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-4499 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4499	miRNA Mature ID	miR-4499
miRNA Sequence	AAGACUGAGAGGAGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4708 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4708	miRNA Mature ID	miR-4708-5p
miRNA Sequence	AGAGAUGCCGCCUUGCUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4770 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4770	miRNA Mature ID	miR-4770
miRNA Sequence	UGAGAUGACACUGUAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-511 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-511	miRNA Mature ID	miR-511-3p
miRNA Sequence	AAUGUGUAGCAAAAGACAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-5584 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5584	miRNA Mature ID	miR-5584-5p
miRNA Sequence	CAGGGAAAUGGGAAGAACUAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-5681a directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5681a	miRNA Mature ID	miR-5681a
miRNA Sequence	AGAAAGGGUGGCAAUACCUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-576 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-576	miRNA Mature ID	miR-576-3p
miRNA Sequence	AAGAUGUGGAAAAAUUGGAAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-6088 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6088	miRNA Mature ID	miR-6088
miRNA Sequence	AGAGAUGAAGCGGGGGGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-6733 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6733	miRNA Mature ID	miR-6733-5p
miRNA Sequence	UGGGAAAGACAAACUCAGAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-6739 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6739	miRNA Mature ID	miR-6739-5p
miRNA Sequence	UGGGAAAGAGAAAGAACAAGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-6760 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6760	miRNA Mature ID	miR-6760-5p
miRNA Sequence	CAGGGAGAAGGUGGAAGUGCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-6761 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6761	miRNA Mature ID	miR-6761-5p
miRNA Sequence	UCUGAGAGAGCUCGAUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6857 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6857	miRNA Mature ID	miR-6857-3p
miRNA Sequence	UGACUGAGCUUCUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-7515 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7515	miRNA Mature ID	miR-7515
miRNA Sequence	AGAAGGGAAGAUGGUGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-873 directly targets SLC2A14			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-873	miRNA Mature ID	miR-873-3p
miRNA Sequence	GGAGACUGAUGAGUUCCCGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-98 directly targets SLC2A14			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Large-scale CpG methylation analysis identifies novel candidate genes and reveals methylation hotspots in acute lymphoblastic leukemia. Cancer Res. 2007 Mar 15;67(6):2617-25.
2	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
6	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
17	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
18	Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
19	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence