Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0258 Transporter Info | ||||
Gene Name | SLC2A3 | ||||
Transporter Name | Glucose transporter type 3, brain | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Hepatocellular carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in hepatocellular carcinoma | [ 1 ] | |||
Location |
5'UTR (cg24655009) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 1.27E-14; Z-score: -4.50E+00 | ||
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in hepatocellular carcinoma | [ 1 ] | |||
Location |
TSS1500 (cg02511315) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 6.67E-03; Z-score: -3.13E-01 | ||
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC2A3 in hepatocellular carcinoma | [ 1 ] | |||
Location |
TSS200 (cg10338338) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 7.64E-04; Z-score: 6.34E-01 | ||
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 2.73E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC2A3 in hepatocellular carcinoma | [ 1 ] | |||
Location |
Body (cg12911449) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.77E-02; Z-score: -4.44E-01 | ||
Methylation in Case |
6.80E-02 (Median) | Methylation in Control | 7.49E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
5'UTR (cg06204922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 7.04E+00 | Statistic Test | p-value: 2.32E-40; Z-score: 6.13E+00 | ||
Methylation in Case |
3.53E-01 (Median) | Methylation in Control | 5.02E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg09448875) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 9.39E-06; Z-score: -1.27E+00 | ||
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in bladder cancer | [ 3 ] | |||
Location |
TSS1500 (cg07748193) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.43E-08; Z-score: -6.96E+00 | ||
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in bladder cancer | [ 3 ] | |||
Location |
Body (cg12911449) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 3.75E-02; Z-score: -9.27E-01 | ||
Methylation in Case |
5.37E-02 (Median) | Methylation in Control | 8.22E-02 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in breast cancer | [ 4 ] | |||
Location |
TSS1500 (cg02511315) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 2.37E-08; Z-score: 1.26E+00 | ||
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.40E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in breast cancer | [ 4 ] | |||
Location |
TSS1500 (cg20313963) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.52E-04; Z-score: 6.70E-01 | ||
Methylation in Case |
4.19E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC2A3 in breast cancer | [ 4 ] | |||
Location |
TSS200 (cg10338338) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.33E-10; Z-score: 1.30E+00 | ||
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 2.53E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC2A3 in breast cancer | [ 4 ] | |||
Location |
TSS200 (cg25580254) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.82E+00 | Statistic Test | p-value: 6.44E-08; Z-score: 1.25E+00 | ||
Methylation in Case |
1.27E-01 (Median) | Methylation in Control | 6.99E-02 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in colorectal cancer | [ 5 ] | |||
Location |
TSS1500 (cg07748193) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 6.74E-06; Z-score: -1.37E+00 | ||
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in colorectal cancer | [ 5 ] | |||
Location |
TSS1500 (cg20313963) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.16E-02; Z-score: -7.80E-01 | ||
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 2.54E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in HIV infection | [ 6 ] | |||
Location |
TSS1500 (cg07748193) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.47E-05; Z-score: 1.78E+00 | ||
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in HIV infection | [ 6 ] | |||
Location |
TSS1500 (cg20313963) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 6.35E-03; Z-score: 5.06E-01 | ||
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 8.96E-02 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC2A3 in HIV infection | [ 6 ] | |||
Location |
TSS200 (cg25580254) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 2.55E-03; Z-score: 8.92E-01 | ||
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 9.31E-02 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in papillary thyroid cancer | [ 7 ] | |||
Location |
TSS1500 (cg20313963) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.73E+00 | Statistic Test | p-value: 2.51E-19; Z-score: -2.51E+00 | ||
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in prostate cancer | [ 8 ] | |||
Location |
TSS1500 (cg09282497) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 4.89E+00 | Statistic Test | p-value: 4.38E-02; Z-score: 1.25E+01 | ||
Methylation in Case |
2.89E-01 (Median) | Methylation in Control | 5.92E-02 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC2A3 in prostate cancer | [ 8 ] | |||
Location |
Body (cg18485596) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 2.64E+00 | Statistic Test | p-value: 2.78E-02; Z-score: 5.73E+00 | ||
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Significant hypermethylation of SLC2A3 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.95E-07; Fold-change: 0.467891021; Z-score: 4.830572521 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in lung adenocarcinoma | [ 9 ] | |||
Location |
TSS200 (cg10338338) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.20E-02; Z-score: 2.60E+00 | ||
Methylation in Case |
3.57E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC2A3 in atypical teratoid rhabdoid tumor | [ 10 ] | |||
Location |
Body (cg12911449) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.15E-02; Z-score: 3.85E-01 | ||
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC2A3 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.35E-07; Fold-change: 0.48379757; Z-score: 19.02130287 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Histone acetylation |
|||||
Non-small cell lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Hypoacetylation of SLC2A3 in non-small cell lung cancer (compare with Vorinostat-treatment counterpart cells) | [ 11 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes |
Down regulation of SLC2A3 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Non-small cell lung cancer [ ICD-11: 2C25.4] | ||||
Experimental Material |
Multiple cell lines of human | ||||
Additional Notes |
SLC2A3 expression can be induced or increased following inhibition of histone deacetylases in non-small cell lung cancer cell lines. | ||||
microRNA |
|||||
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Lower expression of miR-106a in glioblastoma (compare with adjacent normal tissue) | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
Related Molecular Changes |
Down regulation of SLC2A3 | Experiment Method | RT-qPCR | ||
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Glioblastoma [ ICD-11: 2A00.00] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
miR-106a was down-regulated in glioblastoma and regulated SLC2A3 expression via binding to the SLC2A3 mRNA. | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Lower expression of miR-195-5p in bladder cancer (compare with normal cells) | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
Related Molecular Changes |
Down regulation of SLC2A3 | Experiment Method | Western Blot | ||
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Multiple cell lines of human | ||||
Additional Notes |
miR-195-5p was down-regulated in bladder cancer and regulated SLC2A3 expression via binding to the SLC2A3 mRNA. | ||||
Unclear Phenotype |
47 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-103a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-103a | miRNA Mature ID | miR-103a-3p | ||
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-106a directly targets SLC2A3 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
miR-107 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-107 | miRNA Mature ID | miR-107 | ||
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-10a directly targets SLC2A3 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-10a | miRNA Mature ID | miR-10a-5p | ||
miRNA Sequence |
UACCCUGUAGAUCCGAAUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-10b directly targets SLC2A3 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-10b | miRNA Mature ID | miR-10b-5p | ||
miRNA Sequence |
UACCCUGUAGAACCGAAUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-1179 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1179 | miRNA Mature ID | miR-1179 | ||
miRNA Sequence |
AAGCAUUCUUUCAUUGGUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-122 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-1255a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1255a | miRNA Mature ID | miR-1255a | ||
miRNA Sequence |
AGGAUGAGCAAAGAAAGUAGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-1255b directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1255b | miRNA Mature ID | miR-1255b-5p | ||
miRNA Sequence |
CGGAUGAGCAAAGAAAGUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-148a directly targets SLC2A3 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-148a | miRNA Mature ID | miR-148a-3p | ||
miRNA Sequence |
UCAGUGCACUACAGAACUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-15a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-15b directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 13 |
miR-16 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-183 directly targets SLC2A3 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-183 | miRNA Mature ID | miR-183-5p | ||
miRNA Sequence |
UAUGGCACUGGUAGAAUUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-195 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-24 directly targets SLC2A3 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-335 directly targets SLC2A3 | [ 17 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-34a directly targets SLC2A3 | [ 18 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-34a | miRNA Mature ID | miR-34a-5p | ||
miRNA Sequence |
UGGCAGUGUCUUAGCUGGUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human colorectal cancer cell line (SW480) | ||||
Epigenetic Phenomenon 19 |
miR-365a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-3p | ||
miRNA Sequence |
UAAUGCCCCUAAAAAUCCUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-365b directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-3p | ||
miRNA Sequence |
UAAUGCCCCUAAAAAUCCUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-3907 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3907 | miRNA Mature ID | miR-3907 | ||
miRNA Sequence |
AGGUGCUCCAGGCUGGCUCACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-424 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-424 | miRNA Mature ID | miR-424-5p | ||
miRNA Sequence |
CAGCAGCAAUUCAUGUUUUGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 23 |
miR-4310 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4310 | miRNA Mature ID | miR-4310 | ||
miRNA Sequence |
GCAGCAUUCAUGUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-4524a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524a | miRNA Mature ID | miR-4524a-5p | ||
miRNA Sequence |
AUAGCAGCAUGAACCUGUCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 25 |
miR-4524b directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524b | miRNA Mature ID | miR-4524b-5p | ||
miRNA Sequence |
AUAGCAGCAUAAGCCUGUCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-4641 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4641 | miRNA Mature ID | miR-4641 | ||
miRNA Sequence |
UGCCCAUGCCAUACUUUUGCCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 27 |
miR-4654 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4654 | miRNA Mature ID | miR-4654 | ||
miRNA Sequence |
UGUGGGAUCUGGAGGCAUCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 28 |
miR-4769 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4769 | miRNA Mature ID | miR-4769-5p | ||
miRNA Sequence |
GGUGGGAUGGAGAGAAGGUAUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-490 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-490 | miRNA Mature ID | miR-490-5p | ||
miRNA Sequence |
CCAUGGAUCUCCAGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 30 |
miR-497 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-5p | ||
miRNA Sequence |
CAGCAGCACACUGUGGUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 31 |
miR-500a directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-500a | miRNA Mature ID | miR-500a-5p | ||
miRNA Sequence |
UAAUCCUUGCUACCUGGGUGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 32 |
miR-503 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-503 | miRNA Mature ID | miR-503-5p | ||
miRNA Sequence |
UAGCAGCGGGAACAGUUCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 33 |
miR-504 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 34 |
miR-5187 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5187 | miRNA Mature ID | miR-5187-5p | ||
miRNA Sequence |
UGGGAUGAGGGAUUGAAGUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 35 |
miR-539 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-539 | miRNA Mature ID | miR-539-5p | ||
miRNA Sequence |
GGAGAAAUUAUCCUUGGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-562 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-562 | miRNA Mature ID | miR-562 | ||
miRNA Sequence |
AAAGUAGCUGUACCAUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 37 |
miR-606 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-606 | miRNA Mature ID | miR-606 | ||
miRNA Sequence |
AAACUACUGAAAAUCAAAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-646 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-646 | miRNA Mature ID | miR-646 | ||
miRNA Sequence |
AAGCAGCUGCCUCUGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 39 |
miR-6514 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6514 | miRNA Mature ID | miR-6514-5p | ||
miRNA Sequence |
UAUGGAGUGGACUUUCAGCUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-6728 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6728 | miRNA Mature ID | miR-6728-5p | ||
miRNA Sequence |
UUGGGAUGGUAGGACCAGAGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 41 |
miR-6821 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-5p | ||
miRNA Sequence |
GUGCGUGGUGGCUCGAGGCGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 42 |
miR-6838 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6838 | miRNA Mature ID | miR-6838-5p | ||
miRNA Sequence |
AAGCAGCAGUGGCAAGACUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-6847 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6847 | miRNA Mature ID | miR-6847-3p | ||
miRNA Sequence |
GGCUCAUGUGUCUGUCCUCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 44 |
miR-6853 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6853 | miRNA Mature ID | miR-6853-5p | ||
miRNA Sequence |
AGCGUGGGAUGUCCAUGAAGUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 45 |
miR-7157 directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7157 | miRNA Mature ID | miR-7157-5p | ||
miRNA Sequence |
UCAGCAUUCAUUGGCACCAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-892c directly targets SLC2A3 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-892c | miRNA Mature ID | miR-892c-5p | ||
miRNA Sequence |
UAUUCAGAAAGGUGCCAGUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-98 directly targets SLC2A3 | [ 19 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-5p | ||
miRNA Sequence |
UGAGGUAGUAAGUUGUAUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.