Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0262 Transporter Info
Gene Name	SLC2A4
Transporter Name	Glucose transporter type 4, insulin-responsive
Gene ID	6517
UniProt ID	P14672

Epigenetic Regulations of This DT (EGR)
Methylation
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC2A4 in depressive disorder			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	RT-qPCR
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Additional Notes	The methylation level of the GLUT4 significantly increased in depressed inpatients compared to healthy comparison subjects.
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in colon adenocarcinoma			[ 2 ]
Location	5'UTR (cg12718793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.83E+00	Statistic Test	p-value: 1.18E-03; Z-score: -2.13E+00
Methylation in Case	1.52E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in colon adenocarcinoma			[ 2 ]
Location	1stExon (cg17793621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 1.32E-06; Z-score: 2.16E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	3.29E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in colon adenocarcinoma			[ 2 ]
Location	1stExon (cg15012572)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 4.73E-03; Z-score: 1.18E+00
Methylation in Case	3.87E-02 (Median)	Methylation in Control	2.94E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in colon adenocarcinoma			[ 2 ]
Location	Body (cg19930802)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 7.54E-04; Z-score: -2.16E+00
Methylation in Case	8.70E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in bladder cancer			[ 3 ]
Location	TSS1500 (cg02694091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.83E-02; Z-score: -1.55E+00
Methylation in Case	6.97E-02 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in bladder cancer			[ 3 ]
Location	TSS200 (cg09103232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.62E-02; Z-score: -1.58E+00
Methylation in Case	6.65E-02 (Median)	Methylation in Control	8.43E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in bladder cancer			[ 3 ]
Location	Body (cg06891043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.06E-04; Z-score: -3.95E+00
Methylation in Case	4.65E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in bladder cancer			[ 3 ]
Location	3'UTR (cg03670302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 7.39E-11; Z-score: -9.71E+00
Methylation in Case	5.74E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in breast cancer			[ 4 ]
Location	TSS1500 (cg02694091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 7.72E-03; Z-score: -5.94E-01
Methylation in Case	5.95E-02 (Median)	Methylation in Control	7.01E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in breast cancer			[ 4 ]
Location	TSS200 (cg07287120)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.58E-02; Z-score: -2.67E-01
Methylation in Case	5.48E-02 (Median)	Methylation in Control	6.04E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in breast cancer			[ 4 ]
Location	Body (cg27067158)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 2.01E-23; Z-score: 3.87E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	5.96E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in breast cancer			[ 4 ]
Location	Body (cg21994579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 8.82E-05; Z-score: 6.70E-01
Methylation in Case	1.10E-01 (Median)	Methylation in Control	9.48E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg00064950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.27E-02; Z-score: 4.49E-01
Methylation in Case	3.76E-02 (Median)	Methylation in Control	3.45E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg07723558)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.14E-02; Z-score: 1.79E-01
Methylation in Case	4.34E-02 (Median)	Methylation in Control	4.22E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg09103232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 4.70E-03; Z-score: -1.11E+00
Methylation in Case	2.07E-02 (Median)	Methylation in Control	2.93E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg13787272)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 7.77E-03; Z-score: -9.60E-01
Methylation in Case	2.24E-02 (Median)	Methylation in Control	3.06E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A4 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg06891043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.00E-06; Z-score: -2.21E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg07723558)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.10E-02; Z-score: 5.21E-01
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in colorectal cancer			[ 6 ]
Location	TSS200 (cg25362068)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 3.05E-02; Z-score: -3.61E-01
Methylation in Case	2.26E-02 (Median)	Methylation in Control	2.70E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in colorectal cancer			[ 6 ]
Location	Body (cg21994579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 9.88E-06; Z-score: 9.32E-01
Methylation in Case	1.78E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg15971010)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 5.90E-07; Z-score: 1.39E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg06463759)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.53E-02; Z-score: -8.26E-01
Methylation in Case	6.70E-02 (Median)	Methylation in Control	9.14E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg22574986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.48E-03; Z-score: 5.74E-01
Methylation in Case	8.68E-02 (Median)	Methylation in Control	7.40E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in prostate cancer			[ 8 ]
Location	TSS1500 (cg07903677)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 2.72E-03; Z-score: 6.45E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	4.64E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in prostate cancer			[ 8 ]
Location	Body (cg15266604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.79E-04; Z-score: 4.13E+00
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg00064950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.47E-02; Z-score: -1.36E-01
Methylation in Case	9.53E-02 (Median)	Methylation in Control	9.76E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg02694091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.62E-02; Z-score: -1.19E-01
Methylation in Case	7.69E-02 (Median)	Methylation in Control	7.87E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in systemic lupus erythematosus			[ 9 ]
Location	TSS200 (cg13787272)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.99E-04; Z-score: -1.15E-01
Methylation in Case	8.43E-02 (Median)	Methylation in Control	8.61E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg06891043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.37E-02; Z-score: -2.79E-01
Methylation in Case	7.05E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in panic disorder			[ 10 ]
Location	TSS200 (cg07287120)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.93E-01	Statistic Test	p-value: 3.22E-02; Z-score: 1.48E-01
Methylation in Case	-4.98E+00 (Median)	Methylation in Control	-5.01E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg26480745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.47E-03; Z-score: -5.32E-01
Methylation in Case	1.45E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg06891043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.08E-03; Z-score: 7.14E-01
Methylation in Case	7.98E-01 (Median)	Methylation in Control	7.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	3'UTR (cg03670302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.31E-14; Z-score: -2.60E+00
Methylation in Case	6.85E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg03924551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 1.47E-15; Z-score: -4.73E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg13532410)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 1.13E-12; Z-score: -1.76E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	4.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A4 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg27067158)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.68E-03; Z-score: -7.42E-01
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A4 in hepatocellular carcinoma			[ 13 ]
Location	3'UTR (cg03670302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.22E-06; Z-score: -1.79E+00
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in HIV infection			[ 14 ]
Location	Body (cg21994579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 6.25E-05; Z-score: 1.76E+00
Methylation in Case	1.27E-01 (Median)	Methylation in Control	8.71E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in HIV infection			[ 14 ]
Location	3'UTR (cg03670302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.09E-13; Z-score: 2.13E+00
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A4 in lung adenocarcinoma			[ 15 ]
Location	Body (cg06891043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.16E-02; Z-score: -1.23E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A4 in lung adenocarcinoma			[ 15 ]
Location	3'UTR (cg03670302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.98E-03; Z-score: -1.79E+00
Methylation in Case	8.86E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC2A4 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.30E-11; Fold-change: 0.496755918; Z-score: 25.16026682
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Non-small cell lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of SLC2A4 in non-small cell lung cancer (compare with Vorinostat-treatment counterpart cells)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	RT-qPCR
Studied Phenotype	Non-small cell lung cancer [ ICD-11: 2C25.4]
Experimental Material	Multiple cell lines of human
Additional Notes	SLC2A4 expression can be induced or increased following inhibition of histone deacetylases in non-small cell lung cancer cell lines.
Type 1 diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of SLC2A4 in type 1 diabete (compare with counterpart normal rat cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	Western Blot
Studied Phenotype	Type 1 diabetes [ ICD-11: 5A10]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The Type 1 diabetes reduced the H3Kac which would decrease the binding of transcription factors.
Type 2 diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of SLC2A4 in type 2 diabete (compare with counterpart normal rat cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	Western Blot
Studied Phenotype	Type 2 diabetes [ ICD-11: 5A11]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The Type 2 diabetes reduced the H3Kac which would decrease the binding of transcription factors.
Histone trimethylation
Type 1 diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher level of histone trimethylation of SLC2A4 in type 1 diabete (compare with counterpart normal rat cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone trimethylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	Western Blot
Studied Phenotype	Type 1 diabetes [ ICD-11: 5A10]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The Type 1 diabetes reduced the H3Kac and increased the H3K9me3 content, and insulin treatment reversed only the H3K9me3 modification.
Type 2 diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Lower level of histone trimethylation of SLC2A4 in type 2 diabete (compare with counterpart normal rat cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone trimethylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of SLC2A4	Experiment Method	Western Blot
Studied Phenotype	Type 2 diabetes [ ICD-11: 5A11]
Experimental Material	Model organism in vivo (mouse)
Additional Notes	The Type 2 diabetes reduced the H3Kac and increased the H3K9me3 content, and insulin treatment reversed only the H3K9me3 modification.
microRNA
Unclear Phenotype	28 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1286 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1286	miRNA Mature ID	miR-1286
miRNA Sequence	UGCAGGACCAAGAUGAGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1321 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1321	miRNA Mature ID	miR-1321
miRNA Sequence	CAGGGAGGUGAAUGUGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-3121 directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3121	miRNA Mature ID	miR-3121-5p
miRNA Sequence	UCCUUUGCCUAUUCUAUUUAAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 4	miR-335 directly targets SLC2A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-4436a directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4436a	miRNA Mature ID	miR-4436a
miRNA Sequence	GCAGGACAGGCAGAAGUGGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-4510 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4510	miRNA Mature ID	miR-4510
miRNA Sequence	UGAGGGAGUAGGAUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-4709 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4709	miRNA Mature ID	miR-4709-3p
miRNA Sequence	UUGAAGAGGAGGUGCUCUGUAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-4739 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4739	miRNA Mature ID	miR-4739
miRNA Sequence	AAGGGAGGAGGAGCGGAGGGGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-4756 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4756	miRNA Mature ID	miR-4756-5p
miRNA Sequence	CAGGGAGGCGCUCACUCUCUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-5000 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5000	miRNA Mature ID	miR-5000-3p
miRNA Sequence	UCAGGACACUUCUGAACUUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-548ac directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548ac	miRNA Mature ID	miR-548ac
miRNA Sequence	CAAAAACCGGCAAUUACUUUUG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 12	miR-548as directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548as	miRNA Mature ID	miR-548as-3p
miRNA Sequence	UAAAACCCACAAUUAUGUUUGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 13	miR-548bb directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548bb	miRNA Mature ID	miR-548bb-3p
miRNA Sequence	CAAAAACCAUAGUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 14	miR-548d directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548d	miRNA Mature ID	miR-548d-3p
miRNA Sequence	CAAAAACCACAGUUUCUUUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 15	miR-548h directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548h	miRNA Mature ID	miR-548h-3p
miRNA Sequence	CAAAAACCGCAAUUACUUUUGCA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 16	miR-548z directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548z	miRNA Mature ID	miR-548z
miRNA Sequence	CAAAAACCGCAAUUACUUUUGCA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 17	miR-6077 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6077	miRNA Mature ID	miR-6077
miRNA Sequence	GGGAAGAGCUGUACGGCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-6127 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6127	miRNA Mature ID	miR-6127
miRNA Sequence	UGAGGGAGUGGGUGGGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-6129 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6129	miRNA Mature ID	miR-6129
miRNA Sequence	UGAGGGAGUUGGGUGUAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-6130 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6130	miRNA Mature ID	miR-6130
miRNA Sequence	UGAGGGAGUGGAUUGUAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-6133 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6133	miRNA Mature ID	miR-6133
miRNA Sequence	UGAGGGAGGAGGUUGGGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-6771 directly targets SLC2A4			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-3p
miRNA Sequence	CAAACCCCUGUCUACCCGCAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 23	miR-6782 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6782	miRNA Mature ID	miR-6782-5p
miRNA Sequence	UAGGGGUGGGGGAAUUCAGGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6873 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6873	miRNA Mature ID	miR-6873-5p
miRNA Sequence	CAGAGGGAAUACAGAGGGCAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-6880 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6880	miRNA Mature ID	miR-6880-5p
miRNA Sequence	UGGUGGAGGAAGAGGGCAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-7106 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-766 directly targets SLC2A4			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-5p
miRNA Sequence	AGGAGGAAUUGGUGCUGGUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-92a-1 directly targets SLC2A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-92a-1	miRNA Mature ID	miR-92a-1-5p
miRNA Sequence	AGGUUGGGAUCGGUUGCAAUGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Altered DNA methylation of glucose transporter 1 and glucose transporter 4 in patients with major depressive disorder. J Psychiatr Res. 2016 May;76:66-73.
2	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
14	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
15	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
16	Epigenetic regulation of glucose transporters in non-small cell lung cancer. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
17	Diabetes induces tri-methylation at lysine 9 of histone 3 at Slc2a4 gene in skeletal muscle: A new target to improve glycemic control. Mol Cell Endocrinol. 2019 Feb 5;481:26-34.
18	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
19	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
20	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
21	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence