Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0263 Transporter Info
Gene Name	SLC2A5
Transporter Name	Glucose transporter type 5, small intestine
Gene ID	6518
UniProt ID	P22732

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.10E-13; Z-score: 2.23E+00
Methylation in Case	5.73E-01 (Median)	Methylation in Control	4.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg01532168)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.35E+00	Statistic Test	p-value: 9.64E-21; Z-score: 6.22E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	7.67E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg23737366)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.31E-05; Z-score: -9.56E-01
Methylation in Case	7.96E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.93E-07; Z-score: -1.70E+00
Methylation in Case	5.20E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg02289343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.08E-07; Z-score: -2.03E+00
Methylation in Case	8.17E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg06188496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.59E-05; Z-score: -1.10E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg21689824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.32E-05; Z-score: -1.16E+00
Methylation in Case	6.29E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 7.81E-05; Z-score: 1.26E+00
Methylation in Case	6.30E-01 (Median)	Methylation in Control	5.35E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A5 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.64E-02; Z-score: -2.87E-01
Methylation in Case	6.28E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.89E-02; Z-score: -2.71E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.07E+00	Statistic Test	p-value: 4.84E-10; Z-score: -1.51E+01
Methylation in Case	2.47E-01 (Median)	Methylation in Control	5.11E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg02289343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.53E-04; Z-score: -2.73E+00
Methylation in Case	5.37E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg17554996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 7.23E-03; Z-score: -1.98E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.82E-02; Z-score: -2.34E+00
Methylation in Case	6.46E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 4.51E-02; Z-score: -2.61E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	7.56E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A5 in bladder cancer			[ 2 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 4.91E-02; Z-score: 1.97E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	6.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg23737366)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.25E-11; Z-score: 2.38E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 5.28E-06; Z-score: -1.56E+00
Methylation in Case	3.44E-01 (Median)	Methylation in Control	4.81E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 8.43E-19; Z-score: -4.39E+00
Methylation in Case	4.12E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg06188496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 8.65E-12; Z-score: -2.01E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 3.98E-03; Z-score: -9.33E-01
Methylation in Case	5.75E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg17554996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.14E-03; Z-score: -5.86E-01
Methylation in Case	6.53E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg02289343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 5.30E-03; Z-score: -9.19E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.19E-02; Z-score: -8.01E-01
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg21689824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.66E-02; Z-score: -6.16E-01
Methylation in Case	5.00E-01 (Median)	Methylation in Control	5.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.76E-02; Z-score: -6.85E-01
Methylation in Case	5.01E-01 (Median)	Methylation in Control	5.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC2A5 in breast cancer			[ 3 ]
Location	Body (cg18800329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.29E-02; Z-score: -5.51E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 9.88E-13; Z-score: -2.88E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	6.50E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg23737366)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.47E-05; Z-score: -1.38E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in colorectal cancer			[ 4 ]
Location	Body (cg21689824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.02E-04; Z-score: -9.99E-01
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in colorectal cancer			[ 4 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.04E-03; Z-score: -6.19E-01
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in colorectal cancer			[ 4 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.60E-02; Z-score: -4.71E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 5.14E-04; Z-score: 1.50E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 6.61E-15; Z-score: 5.11E+00
Methylation in Case	9.28E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg17554996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.31E-13; Z-score: 2.66E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 2.86E-10; Z-score: -2.80E+00
Methylation in Case	4.41E-01 (Median)	Methylation in Control	6.40E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.66E+00	Statistic Test	p-value: 1.63E-09; Z-score: 3.63E+00
Methylation in Case	3.15E-01 (Median)	Methylation in Control	1.90E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg06188496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 4.92E-08; Z-score: 2.12E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	3.42E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 5.01E-08; Z-score: 2.93E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A5 in HIV infection			[ 5 ]
Location	Body (cg21689824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.05E-06; Z-score: 1.46E+00
Methylation in Case	3.89E-01 (Median)	Methylation in Control	3.30E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in papillary thyroid cancer			[ 6 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 4.40E-05; Z-score: -1.30E+00
Methylation in Case	6.79E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in papillary thyroid cancer			[ 6 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.85E-03; Z-score: 9.49E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in papillary thyroid cancer			[ 6 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.53E-03; Z-score: 6.33E-01
Methylation in Case	7.14E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in systemic lupus erythematosus			[ 7 ]
Location	TSS1500 (cg16104584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.08E-02; Z-score: -3.65E-01
Methylation in Case	5.15E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in systemic lupus erythematosus			[ 7 ]
Location	Body (cg25602242)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.91E-02; Z-score: 2.41E-01
Methylation in Case	3.66E-01 (Median)	Methylation in Control	3.39E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in systemic lupus erythematosus			[ 7 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.12E-02; Z-score: -1.65E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg23752563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.95E+00	Statistic Test	p-value: 3.41E-10; Z-score: 1.70E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	1.71E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg06646493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 9.44E-04; Z-score: -8.01E-01
Methylation in Case	1.47E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg22284058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 6.78E-04; Z-score: 9.90E-01
Methylation in Case	7.25E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg18274791)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 7.35E-04; Z-score: 6.29E-01
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg13359765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 7.27E-03; Z-score: -8.36E-01
Methylation in Case	3.09E-01 (Median)	Methylation in Control	3.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg07478944)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.01E-02; Z-score: 8.89E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg03971338)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.10E-02; Z-score: 6.10E-02
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC2A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg23701033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.41E-02; Z-score: -5.95E-01
Methylation in Case	6.22E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg02289343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.22E+00	Statistic Test	p-value: 1.42E-04; Z-score: -8.27E-01
Methylation in Case	9.69E-02 (Median)	Methylation in Control	2.15E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg06188496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.24E-03; Z-score: 4.73E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.96E-02; Z-score: 4.24E-01
Methylation in Case	8.94E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.64E+00	Statistic Test	p-value: 4.78E-02; Z-score: -1.89E-01
Methylation in Case	3.14E-02 (Median)	Methylation in Control	5.15E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in lung adenocarcinoma			[ 10 ]
Location	Body (cg17554996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.04E-03; Z-score: 1.93E+00
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in lung adenocarcinoma			[ 10 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.59E-02; Z-score: -1.69E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in panic disorder			[ 11 ]
Location	Body (cg17554996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 2.36E-03; Z-score: -5.73E-01
Methylation in Case	1.31E+00 (Median)	Methylation in Control	1.52E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in panic disorder			[ 11 ]
Location	Body (cg06188496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.09E-01	Statistic Test	p-value: 3.49E-03; Z-score: -3.53E-01
Methylation in Case	-1.49E+00 (Median)	Methylation in Control	-1.36E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in panic disorder			[ 11 ]
Location	Body (cg17243628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.98E-02; Z-score: -2.98E-01
Methylation in Case	1.35E+00 (Median)	Methylation in Control	1.49E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC2A5 in panic disorder			[ 11 ]
Location	Body (cg13869484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.31E-01	Statistic Test	p-value: 4.35E-02; Z-score: 4.80E-01
Methylation in Case	-8.30E-02 (Median)	Methylation in Control	-2.51E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC2A5 in prostate cancer			[ 12 ]
Location	Body (cg20439022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 4.79E-03; Z-score: 2.84E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC2A5 in prostate cancer			[ 12 ]
Location	Body (cg20561863)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.85E+00	Statistic Test	p-value: 1.73E-02; Z-score: 2.72E+00
Methylation in Case	5.46E-01 (Median)	Methylation in Control	2.95E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC2A5 in prostate cancer			[ 12 ]
Location	Body (cg17383222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 1.79E-02; Z-score: 2.57E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	5.71E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC2A5 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.88E-09; Fold-change: -0.515929085; Z-score: -15.86772438
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Fructose-fed mice	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of SLC2A5 in fructose force-fed mice (compare with glucose force-fed mice)			[ 13 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Up regulation of SLC2A5	Experiment Method	RT-qPCR
Studied Phenotype	Fructose-fed mice
Experimental Material	Model organism in vivo (mouse)
Additional Notes	Jejunal expression of Slc2a5 by fructose force-feeding involved inducing the acetylation of histone H3 at K9 and of H4 at K5/16 around the Slc2a5 gene.
Epigenetic Phenomenon 2	Hypoacetylation of SLC2A5 in fructose force-fed mice (compare with glucose force-fed mice)			[ 13 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Up regulation of SLC2A5	Experiment Method	RT-qPCR
Studied Phenotype	Fructose-fed mice
Experimental Material	Model organism in vivo (mouse)
Additional Notes	Jejunal expression of Slc2a5 by fructose force-feeding involved inducing the acetylation of histone H3 at K9 and of H4 at K5/16 around the Slc2a5 gene.
microRNA
Unclear Phenotype	49 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1226 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1226	miRNA Mature ID	miR-1226-5p
miRNA Sequence	GUGAGGGCAUGCAGGCCUGGAUGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1247 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1247	miRNA Mature ID	miR-1247-3p
miRNA Sequence	CCCCGGGAACGUCGAGACUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1266 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1266	miRNA Mature ID	miR-1266-3p
miRNA Sequence	CCCUGUUCUAUGCCCUGAGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1304 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-5p
miRNA Sequence	UUUGAGGCUACAGUGAGAUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-140 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-140	miRNA Mature ID	miR-140-3p
miRNA Sequence	UACCACAGGGUAGAACCACGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-1827 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-1914 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1914	miRNA Mature ID	miR-1914-3p
miRNA Sequence	GGAGGGGUCCCGCACUGGGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-3135a directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3135a	miRNA Mature ID	miR-3135a
miRNA Sequence	UGCCUAGGCUGAGACUGCAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3184 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3184	miRNA Mature ID	miR-3184-5p
miRNA Sequence	UGAGGGGCCUCAGACCGAGCUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-3650 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3650	miRNA Mature ID	miR-3650
miRNA Sequence	AGGUGUGUCUGUAGAGUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3664 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3664	miRNA Mature ID	miR-3664-3p
miRNA Sequence	UCUCAGGAGUAAAGACAGAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-3689d directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3689d	miRNA Mature ID	miR-3689d
miRNA Sequence	GGGAGGUGUGAUCUCACACUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-383 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-383	miRNA Mature ID	miR-383-3p
miRNA Sequence	ACAGCACUGCCUGGUCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-3914 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3914	miRNA Mature ID	miR-3914
miRNA Sequence	AAGGAACCAGAAAAUGAGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-3929 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-423 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-423	miRNA Mature ID	miR-423-5p
miRNA Sequence	UGAGGGGCAGAGAGCGAGACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-4302 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4302	miRNA Mature ID	miR-4302
miRNA Sequence	CCAGUGUGGCUCAGCGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4326 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4326	miRNA Mature ID	miR-4326
miRNA Sequence	UGUUCCUCUGUCUCCCAGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4433a directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433a	miRNA Mature ID	miR-4433a-3p
miRNA Sequence	ACAGGAGUGGGGGUGGGACAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-4478 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 21	miR-4649 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4649	miRNA Mature ID	miR-4649-3p
miRNA Sequence	UCUGAGGCCUGCCUCUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-4695 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4695	miRNA Mature ID	miR-4695-5p
miRNA Sequence	CAGGAGGCAGUGGGCGAGCAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-4722 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-5p
miRNA Sequence	GGCAGGAGGGCUGUGCCAGGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-4768 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-3p
miRNA Sequence	CCAGGAGAUCCAGAGAGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-4790 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4790	miRNA Mature ID	miR-4790-3p
miRNA Sequence	UGAAUGGUAAAGCGAUGUCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-485 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 27	miR-510 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-510	miRNA Mature ID	miR-510-5p
miRNA Sequence	UACUCAGGAGAGUGGCAAUCAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-512 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-512	miRNA Mature ID	miR-512-5p
miRNA Sequence	CACUCAGCCUUGAGGGCACUUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-5194 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5194	miRNA Mature ID	miR-5194
miRNA Sequence	UGAGGGGUUUGGAAUGGGAUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-649 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-649	miRNA Mature ID	miR-649
miRNA Sequence	AAACCUGUGUUGUUCAAGAGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-665 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-670 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-670	miRNA Mature ID	miR-670-3p
miRNA Sequence	UUUCCUCAUAUUCAUUCAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-6733 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6733	miRNA Mature ID	miR-6733-3p
miRNA Sequence	UCAGUGUCUGGAUUUCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-6734 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6734	miRNA Mature ID	miR-6734-5p
miRNA Sequence	UUGAGGGGAGAAUGAGGUGGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-6738 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6738	miRNA Mature ID	miR-6738-5p
miRNA Sequence	CGAGGGGUAGAAGAGCACAGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6799 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6802 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6802	miRNA Mature ID	miR-6802-5p
miRNA Sequence	CUAGGUGGGGGGCUUGAAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-6808 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-6815 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6815	miRNA Mature ID	miR-6815-5p
miRNA Sequence	UAGGUGGCGCCGGAGGAGUCAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-6834 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6834	miRNA Mature ID	miR-6834-5p
miRNA Sequence	GUGAGGGACUGGGAUUUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-6851 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6851	miRNA Mature ID	miR-6851-5p
miRNA Sequence	AGGAGGUGGUACUAGGGGCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-6865 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6865	miRNA Mature ID	miR-6865-5p
miRNA Sequence	UAGGUGGCAGAGGAGGGACUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-6884 directly targets SLC2A5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 44	miR-6893 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-7160 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-7977 directly targets SLC2A5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7977	miRNA Mature ID	miR-7977
miRNA Sequence	UUCCCAGCCAACGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 47	miR-873 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-873	miRNA Mature ID	miR-873-5p
miRNA Sequence	GCAGGAACUUGUGAGUCUCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 48	miR-9 directly targets SLC2A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-5p
miRNA Sequence	UCUUUGGUUAUCUAGCUGUAUGA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 49	miR-940 directly targets SLC2A5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Induction by fructose force-feeding of histone H3 and H4 acetylation at their lysine residues around the Slc2a5 gene and its expression in mice. Biosci Biotechnol Biochem. 2013;77(11):2188-91.
14	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
15	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
16	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
17	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence