Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0264 Transporter Info | ||||
Gene Name | SLC2A6 | ||||
Transporter Name | Glucose transporter type 6 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1227 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-3p | ||
miRNA Sequence |
CGUGCCACCCUUUUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-129 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-208a directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-208a | miRNA Mature ID | miR-208a-5p | ||
miRNA Sequence |
GAGCUUUUGGCCCGGGUUAUAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-208b directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-208b | miRNA Mature ID | miR-208b-5p | ||
miRNA Sequence |
AAGCUUUUUGCUCGAAUUAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-26b directly targets SLC2A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 6 |
miR-3149 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3149 | miRNA Mature ID | miR-3149 | ||
miRNA Sequence |
UUUGUAUGGAUAUGUGUGUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-3665 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3665 | miRNA Mature ID | miR-3665 | ||
miRNA Sequence |
AGCAGGUGCGGGGCGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 8 |
miR-3674 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3674 | miRNA Mature ID | miR-3674 | ||
miRNA Sequence |
AUUGUAGAACCUAAGAUUGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 9 |
miR-4464 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4464 | miRNA Mature ID | miR-4464 | ||
miRNA Sequence |
AAGGUUUGGAUAGAUGCAAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 10 |
miR-4701 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-4715 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4715 | miRNA Mature ID | miR-4715-3p | ||
miRNA Sequence |
GUGCCACCUUAACUGCAGCCAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-4748 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4748 | miRNA Mature ID | miR-4748 | ||
miRNA Sequence |
GAGGUUUGGGGAGGAUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 13 |
miR-500b directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-5087 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5087 | miRNA Mature ID | miR-5087 | ||
miRNA Sequence |
GGGUUUGUAGCUUUGCUGGCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 15 |
miR-657 directly targets SLC2A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-657 | miRNA Mature ID | miR-657 | ||
miRNA Sequence |
GGCAGGUUCUCACCCUCUCUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 16 |
miR-6867 directly targets SLC2A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-92a directly targets SLC2A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.