Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0266 Transporter Info
Gene Name SLC2A8
Transporter Name Glucose transporter type 8
Gene ID
29988
UniProt ID
Q9NY64
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg00797102)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.84E+00 Statistic Test p-value: 4.74E-17; Z-score: -2.99E+00

Methylation in Case

 3.02E-01 (Median) Methylation in Control 5.56E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.03E-09; Z-score: -1.84E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg06178383)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 1.98E-17; Z-score: -2.38E+00

Methylation in Case

 2.50E-01 (Median) Methylation in Control 3.81E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.55E-06; Z-score: 1.13E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg14479094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.69E-04; Z-score: 8.23E-01

Methylation in Case

 8.00E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A8 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg14018434)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.44E-03; Z-score: 4.52E-01

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg21202529)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 7.74E-07; Z-score: 1.38E+00

Methylation in Case

 8.64E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg18588052)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 8.38E-04; Z-score: -6.24E-01

Methylation in Case

 6.55E-02 (Median) Methylation in Control 7.16E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg19235418)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.42E-03; Z-score: -1.99E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in bladder cancer [ 3 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.91E+00 Statistic Test p-value: 2.73E-10; Z-score: -1.12E+01

Methylation in Case

 3.34E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in bladder cancer [ 3 ]

Location

 Body (cg00577364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.09E-02; Z-score: -1.45E+00

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in breast cancer [ 4 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 9.92E-05; Z-score: -8.87E-01

Methylation in Case

 7.25E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in breast cancer [ 4 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 4.70E-03; Z-score: -8.05E-01

Methylation in Case

 6.90E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in breast cancer [ 4 ]

Location

 Body (cg14479094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 7.52E-03; Z-score: 1.03E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.43E-07; Z-score: 2.60E+00

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.13E-04; Z-score: -1.28E+00

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg03804985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.06E-02; Z-score: 4.92E-02

Methylation in Case

 2.51E-02 (Median) Methylation in Control 2.49E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in colon adenocarcinoma [ 6 ]

Location

 TSS1500 (cg11346522)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 5.90E-05; Z-score: -1.68E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 5.98E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in colon adenocarcinoma [ 6 ]

Location

 TSS200 (cg18313899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.52E+00 Statistic Test p-value: 5.32E-07; Z-score: 7.09E+00

Methylation in Case

 3.20E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in colon adenocarcinoma [ 6 ]

Location

 Body (cg26607031)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.46E-03; Z-score: 7.21E-01

Methylation in Case

 3.98E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in colorectal cancer [ 7 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 8.38E-09; Z-score: -2.28E+00

Methylation in Case

 6.26E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in colorectal cancer [ 7 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.76E-03; Z-score: -1.01E+00

Methylation in Case

 7.75E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in colorectal cancer [ 7 ]

Location

 Body (cg00757413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 3.35E-02; Z-score: 6.00E-01

Methylation in Case

 1.13E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in HIV infection [ 8 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.33E-10; Z-score: 1.30E+00

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in HIV infection [ 8 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.10E-07; Z-score: 2.19E+00

Methylation in Case

 6.27E-01 (Median) Methylation in Control 5.45E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg00114012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 5.33E-03; Z-score: 1.39E+00

Methylation in Case

 7.61E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in lung adenocarcinoma [ 9 ]

Location

 Body (cg14479094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 6.19E-03; Z-score: 1.45E+00

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg00577364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 2.98E-05; Z-score: 1.33E+00

Methylation in Case

 6.02E-01 (Median) Methylation in Control 3.91E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg00757413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 3.89E-05; Z-score: 9.20E-01

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg03804985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.37E-04; Z-score: 1.21E+00

Methylation in Case

 7.81E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg13692482)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 3.83E-02; Z-score: -8.34E-01

Methylation in Case

 1.56E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg14018434)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 4.22E-02; Z-score: 4.01E-01

Methylation in Case

 2.00E-01 (Median) Methylation in Control 1.75E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 4.37E-02; Z-score: 5.64E-01

Methylation in Case

 1.65E-02 (Median) Methylation in Control 1.34E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC2A8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg14479094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.65E-02; Z-score: 2.42E-01

Methylation in Case

 8.11E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in panic disorder [ 11 ]

Location

 Body (cg14250560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.20E+00 Statistic Test p-value: 2.92E-02; Z-score: -3.93E-01

Methylation in Case

 8.25E-02 (Median) Methylation in Control 1.82E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in papillary thyroid cancer [ 12 ]

Location

 Body (cg14479094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.04E-08; Z-score: 1.40E+00

Methylation in Case

 9.09E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC2A8 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg00577364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.17E-02; Z-score: -3.21E-01

Methylation in Case

 9.09E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC2A8 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg03804985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.74E-02; Z-score: 1.88E-01

Methylation in Case

 3.12E-02 (Median) Methylation in Control 2.96E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          30 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1249 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1249 miRNA Mature ID miR-1249-5p

miRNA Sequence

 AGGAGGGAGGAGAUGGGCCAAGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1587 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1587 miRNA Mature ID miR-1587

miRNA Sequence

 UUGGGCUGGGCUGGGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-3135b directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

 GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-3620 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3620 miRNA Mature ID miR-3620-5p

miRNA Sequence

 GUGGGCUGGGCUGGGCUGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-3652 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

 CGGCUGGAGGUGUGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-3943 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3943 miRNA Mature ID miR-3943

miRNA Sequence

 UAGCCCCCAGGCUUCACUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4323 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4323 miRNA Mature ID miR-4323

miRNA Sequence

 CAGCCCCACAGCCUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4430 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

 AGGCUGGAGUGAGCGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4492 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4492 miRNA Mature ID miR-4492

miRNA Sequence

 GGGGCUGGGCGCGCGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4498 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4498 miRNA Mature ID miR-4498

miRNA Sequence

 UGGGCUGGCAGGGCAAGUGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4510 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4510 miRNA Mature ID miR-4510

miRNA Sequence

 UGAGGGAGUAGGAUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-4656 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4656 miRNA Mature ID miR-4656

miRNA Sequence

 UGGGCUGAGGGCAGGAGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4675 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4675 miRNA Mature ID miR-4675

miRNA Sequence

 GGGGCUGUGAUUGACCAGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4741 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4741 miRNA Mature ID miR-4741

miRNA Sequence

 CGGGCUGUCCGGAGGGGUCGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-5001 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5001 miRNA Mature ID miR-5001-5p

miRNA Sequence

 AGGGCUGGACUCAGCGGCGGAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-5089 directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

 GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-548m directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548m miRNA Mature ID miR-548m

miRNA Sequence

 CAAAGGUAUUUGUGGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-5587 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5587 miRNA Mature ID miR-5587-3p

miRNA Sequence

 GCCCCGGGCAGUGUGAUCAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-6127 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6127 miRNA Mature ID miR-6127

miRNA Sequence

 UGAGGGAGUGGGUGGGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-6129 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6129 miRNA Mature ID miR-6129

miRNA Sequence

 UGAGGGAGUUGGGUGUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-6130 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6130 miRNA Mature ID miR-6130

miRNA Sequence

 UGAGGGAGUGGAUUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-6133 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6133 miRNA Mature ID miR-6133

miRNA Sequence

 UGAGGGAGGAGGUUGGGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-619 directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

 GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-6506 directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

 ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-6515 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6515 miRNA Mature ID miR-6515-5p

miRNA Sequence

 UUGGAGGGUGUGGAAGACAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-6797 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6797 miRNA Mature ID miR-6797-5p

miRNA Sequence

 AGGAGGGAAGGGGCUGAGAACAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-6807 directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-6829 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6829 miRNA Mature ID miR-6829-5p

miRNA Sequence

 UGGGCUGCUGAGAAGGGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-6835 directly targets SLC2A8 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-762 directly targets SLC2A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-762 miRNA Mature ID miR-762

miRNA Sequence

 GGGGCUGGGGCCGGGGCCGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
15 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.