Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0270 Transporter Info
Gene Name	SLC30A10
Transporter Name	Zinc transporter 10
Gene ID	55532
UniProt ID	Q6XR72

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg22146252)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.10E-03; Z-score: 1.89E+00
Methylation in Case	4.37E-01 (Median)	Methylation in Control	3.63E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg22048683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 5.70E-08; Z-score: -1.62E+00
Methylation in Case	4.22E-01 (Median)	Methylation in Control	4.74E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg03993463)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.77E-05; Z-score: -1.93E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg06236276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 8.05E-04; Z-score: 1.11E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg20979061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 1.58E-06; Z-score: 2.64E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg25214305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 2.28E-06; Z-score: -3.25E+00
Methylation in Case	5.64E-01 (Median)	Methylation in Control	7.38E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg20241270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 4.33E-06; Z-score: -4.30E+00
Methylation in Case	6.66E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.03E+00	Statistic Test	p-value: 2.22E-05; Z-score: 5.50E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	9.94E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg03700302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 4.10E-05; Z-score: -3.91E+00
Methylation in Case	5.84E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg01206944)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.08E-04; Z-score: -6.98E-01
Methylation in Case	3.29E-01 (Median)	Methylation in Control	3.80E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in colon adenocarcinoma			[ 1 ]
Location	Body (cg26840162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 9.19E-04; Z-score: -1.38E+00
Methylation in Case	8.38E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg02821501)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.27E-05; Z-score: 5.23E-01
Methylation in Case	4.55E-02 (Median)	Methylation in Control	4.03E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg00755448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.48E-15; Z-score: 1.42E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	1.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg02136132)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.68E+00	Statistic Test	p-value: 2.65E-13; Z-score: 2.00E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	8.28E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg00748432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 7.04E-13; Z-score: -2.04E+00
Methylation in Case	3.55E-01 (Median)	Methylation in Control	4.48E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg00727912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 2.52E-12; Z-score: -1.81E+00
Methylation in Case	3.14E-01 (Median)	Methylation in Control	3.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg00995065)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.02E-03; Z-score: -1.50E-01
Methylation in Case	6.95E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg13285458)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.71E-02; Z-score: -3.53E-01
Methylation in Case	4.57E-02 (Median)	Methylation in Control	5.03E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg26313337)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 6.15E-12; Z-score: -1.61E+00
Methylation in Case	6.58E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg16163535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 3.65E-03; Z-score: -1.08E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg02501120)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.46E-02; Z-score: -2.26E-01
Methylation in Case	5.10E-02 (Median)	Methylation in Control	5.60E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg13711063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.48E-09; Z-score: -1.50E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in prostate cancer			[ 3 ]
Location	5'UTR (cg09552652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.51E-02; Z-score: 2.44E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in prostate cancer			[ 3 ]
Location	TSS1500 (cg02515800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 2.32E-02; Z-score: -1.98E+00
Methylation in Case	1.87E-01 (Median)	Methylation in Control	2.80E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in prostate cancer			[ 3 ]
Location	TSS200 (cg20780337)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.57E+00	Statistic Test	p-value: 1.18E-02; Z-score: 4.03E+00
Methylation in Case	7.08E-02 (Median)	Methylation in Control	4.50E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in prostate cancer			[ 3 ]
Location	1stExon (cg06723421)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.36E-02; Z-score: 2.73E+00
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in prostate cancer			[ 3 ]
Location	Body (cg12565580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 3.06E-02; Z-score: -2.34E+00
Methylation in Case	6.32E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS1500 (cg05155775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 1.64E-10; Z-score: -7.71E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 6.01E-08; Z-score: -6.02E+00
Methylation in Case	3.18E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.87E+00	Statistic Test	p-value: 2.95E-07; Z-score: -6.14E+00
Methylation in Case	3.09E-01 (Median)	Methylation in Control	5.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 2.70E-06; Z-score: -4.50E+00
Methylation in Case	2.96E-01 (Median)	Methylation in Control	4.35E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS200 (cg12355180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 2.12E-02; Z-score: -3.20E+00
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 2.90E-02; Z-score: -1.29E+00
Methylation in Case	6.93E-02 (Median)	Methylation in Control	9.58E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	Body (cg16814688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 5.50E-11; Z-score: -9.55E+00
Methylation in Case	4.24E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	Body (cg07005353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 7.62E-06; Z-score: -7.12E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	Body (cg27629095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 1.83E-04; Z-score: -3.97E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in bladder cancer			[ 4 ]
Location	Body (cg07948194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.26E-03; Z-score: -2.85E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	TSS1500 (cg05155775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.31E-10; Z-score: -2.32E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	TSS1500 (cg02557906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 5.16E-07; Z-score: -1.37E+00
Methylation in Case	6.05E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.63E-06; Z-score: -9.97E-01
Methylation in Case	6.61E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	TSS200 (cg12355180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.42E-06; Z-score: 5.95E-01
Methylation in Case	1.79E-01 (Median)	Methylation in Control	1.58E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.44E-02; Z-score: 1.39E-01
Methylation in Case	7.51E-02 (Median)	Methylation in Control	7.02E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.83E+00	Statistic Test	p-value: 2.16E-13; Z-score: 2.75E+00
Methylation in Case	2.55E-01 (Median)	Methylation in Control	1.40E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.82E+00	Statistic Test	p-value: 2.31E-12; Z-score: 3.21E+00
Methylation in Case	2.52E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.04E+00	Statistic Test	p-value: 1.18E-10; Z-score: 2.31E+00
Methylation in Case	2.17E-01 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.64E+00	Statistic Test	p-value: 1.40E-09; Z-score: 1.79E+00
Methylation in Case	1.28E-01 (Median)	Methylation in Control	4.86E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.43E+00	Statistic Test	p-value: 2.05E-06; Z-score: 9.28E-01
Methylation in Case	5.34E-02 (Median)	Methylation in Control	2.20E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	Body (cg16814688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.34E-06; Z-score: -1.40E+00
Methylation in Case	6.67E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	Body (cg07005353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.06E-05; Z-score: -8.60E-01
Methylation in Case	7.75E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	Body (cg27629095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 5.99E-04; Z-score: -6.13E-01
Methylation in Case	6.15E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC30A10 in breast cancer			[ 5 ]
Location	Body (cg07948194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 9.91E-03; Z-score: -2.88E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 8.51E-10; Z-score: 2.42E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.11E-06; Z-score: 3.78E+00
Methylation in Case	6.53E-01 (Median)	Methylation in Control	5.33E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg05155775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.79E-03; Z-score: -2.12E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 7.06E-03; Z-score: 1.86E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 5.76E-03; Z-score: 6.24E-01
Methylation in Case	4.42E-02 (Median)	Methylation in Control	3.88E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.66E+00	Statistic Test	p-value: 1.31E-06; Z-score: 3.15E+00
Methylation in Case	2.31E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.39E+00	Statistic Test	p-value: 5.40E-06; Z-score: 3.48E+00
Methylation in Case	1.28E-01 (Median)	Methylation in Control	5.35E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 5.44E-05; Z-score: 2.69E+00
Methylation in Case	4.46E-02 (Median)	Methylation in Control	3.01E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 7.72E-05; Z-score: 1.51E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.08E+00	Statistic Test	p-value: 1.39E-04; Z-score: 2.04E+00
Methylation in Case	4.65E-02 (Median)	Methylation in Control	2.23E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in clear cell renal cell carcinoma			[ 6 ]
Location	Body (cg07948194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.08E-03; Z-score: -7.55E-01
Methylation in Case	9.74E-01 (Median)	Methylation in Control	9.79E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 4.67E-03; Z-score: 1.14E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	6.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 5.62E-03; Z-score: 1.11E+00
Methylation in Case	6.91E-01 (Median)	Methylation in Control	6.30E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	TSS200 (cg12355180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 4.85E-07; Z-score: 1.23E+00
Methylation in Case	2.21E-01 (Median)	Methylation in Control	1.89E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 6.44E-06; Z-score: 1.33E+00
Methylation in Case	5.39E-02 (Median)	Methylation in Control	3.95E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.29E+00	Statistic Test	p-value: 1.15E-19; Z-score: 4.95E+00
Methylation in Case	5.85E-01 (Median)	Methylation in Control	2.56E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.27E+00	Statistic Test	p-value: 1.60E-16; Z-score: 4.28E+00
Methylation in Case	6.09E-01 (Median)	Methylation in Control	2.68E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.88E+00	Statistic Test	p-value: 2.84E-12; Z-score: 5.37E+00
Methylation in Case	3.08E-01 (Median)	Methylation in Control	6.30E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 8.90E+00	Statistic Test	p-value: 4.20E-12; Z-score: 1.63E+01
Methylation in Case	3.35E-01 (Median)	Methylation in Control	3.77E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in colorectal cancer			[ 7 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 7.35E+00	Statistic Test	p-value: 5.34E-12; Z-score: 9.26E+00
Methylation in Case	1.73E-01 (Median)	Methylation in Control	2.36E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Hypermethylation of SLC30A10 in colorectal cancer			[ 15 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	MeDIP-Chip
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in depression			[ 8 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.25E-02; Z-score: 4.57E-01
Methylation in Case	6.42E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	19 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg09715906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 2.61E-14; Z-score: -2.42E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.03E-04; Z-score: -1.18E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	4.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 3.71E-04; Z-score: -1.16E+00
Methylation in Case	3.65E-01 (Median)	Methylation in Control	4.65E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg02557906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 6.64E-04; Z-score: -1.21E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg11207307)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.98E+00	Statistic Test	p-value: 7.66E-19; Z-score: 3.34E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.75E-05; Z-score: -8.17E-01
Methylation in Case	4.36E-02 (Median)	Methylation in Control	5.45E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 2.39E-09; Z-score: -1.27E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.71E+00	Statistic Test	p-value: 1.33E-07; Z-score: -9.90E-01
Methylation in Case	4.90E-02 (Median)	Methylation in Control	8.37E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.42E-07; Z-score: -1.11E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 4.97E-05; Z-score: -6.88E-01
Methylation in Case	2.13E-02 (Median)	Methylation in Control	3.20E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 9.29E-03; Z-score: -5.19E-01
Methylation in Case	3.20E-02 (Median)	Methylation in Control	4.37E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg13096859)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.64E+00	Statistic Test	p-value: 2.18E-21; Z-score: -1.12E+01
Methylation in Case	5.02E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg12860764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 1.16E-19; Z-score: -7.99E+00
Methylation in Case	4.76E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg11112833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 3.19E-18; Z-score: -1.12E+01
Methylation in Case	5.17E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg05603680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 2.31E-14; Z-score: -4.35E+00
Methylation in Case	3.88E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg12223004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.88E+00	Statistic Test	p-value: 4.60E-14; Z-score: -5.09E+00
Methylation in Case	3.22E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg01266985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.56E-12; Z-score: 1.26E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	6.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg07005353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 2.64E-06; Z-score: -1.11E+00
Methylation in Case	4.42E-01 (Median)	Methylation in Control	5.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of SLC30A10 in hepatocellular carcinoma			[ 9 ]
Location	3'UTR (cg15149374)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 2.67E-15; Z-score: -4.74E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS1500 (cg05155775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 3.03E-05; Z-score: 8.65E-01
Methylation in Case	7.99E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.13E-04; Z-score: 1.17E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.33E-03; Z-score: 4.61E-01
Methylation in Case	7.61E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS1500 (cg02557906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.29E-02; Z-score: 4.98E-01
Methylation in Case	7.25E-01 (Median)	Methylation in Control	6.98E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.35E-02; Z-score: 6.47E-01
Methylation in Case	6.05E-01 (Median)	Methylation in Control	5.65E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS200 (cg12355180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 4.20E-05; Z-score: 1.23E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	9.42E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	TSS200 (cg25841634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 9.18E-03; Z-score: 8.68E-01
Methylation in Case	6.07E-02 (Median)	Methylation in Control	4.30E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 2.09E-05; Z-score: 3.01E+00
Methylation in Case	1.72E-01 (Median)	Methylation in Control	9.09E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 2.16E-05; Z-score: 2.54E+00
Methylation in Case	7.15E-02 (Median)	Methylation in Control	2.96E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 2.71E-05; Z-score: 1.52E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.36E+00	Statistic Test	p-value: 4.15E-04; Z-score: 1.71E+00
Methylation in Case	4.39E-02 (Median)	Methylation in Control	1.86E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 7.12E-04; Z-score: 1.12E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	Body (cg27629095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.08E-05; Z-score: -1.84E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC30A10 in HIV infection			[ 10 ]
Location	Body (cg16814688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.97E-02; Z-score: -8.30E-01
Methylation in Case	7.87E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg21648401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.04E-04; Z-score: 2.15E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.88E-03; Z-score: 1.90E+00
Methylation in Case	6.43E-01 (Median)	Methylation in Control	5.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.25E-02; Z-score: 2.78E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg12355180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 1.33E-02; Z-score: 3.74E+00
Methylation in Case	2.32E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.68E+00	Statistic Test	p-value: 2.62E-03; Z-score: 8.38E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.27E+00	Statistic Test	p-value: 3.13E-03; Z-score: 1.38E+01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 4.08E-03; Z-score: 3.02E+00
Methylation in Case	3.78E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.83E+00	Statistic Test	p-value: 9.81E-03; Z-score: 6.00E+00
Methylation in Case	3.39E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.39E+00	Statistic Test	p-value: 1.47E-02; Z-score: 7.58E+00
Methylation in Case	2.70E-01 (Median)	Methylation in Control	7.96E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	Body (cg16814688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.28E-04; Z-score: -2.49E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC30A10 in lung adenocarcinoma			[ 11 ]
Location	Body (cg27629095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.30E-02; Z-score: -1.11E+00
Methylation in Case	6.79E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.31E-03; Z-score: 9.76E-01
Methylation in Case	7.71E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg27295373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.16E-03; Z-score: 9.14E-01
Methylation in Case	5.51E-01 (Median)	Methylation in Control	5.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.53E-04; Z-score: 6.61E-01
Methylation in Case	9.34E-02 (Median)	Methylation in Control	8.33E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 8.88E-04; Z-score: 7.55E-01
Methylation in Case	1.27E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.66E-03; Z-score: 3.97E-01
Methylation in Case	5.30E-02 (Median)	Methylation in Control	4.75E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.99E-02; Z-score: 3.84E-01
Methylation in Case	1.12E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	Body (cg16814688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.37E-10; Z-score: -2.06E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	Body (cg27629095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.97E-09; Z-score: -1.44E+00
Methylation in Case	8.12E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC30A10 in papillary thyroid cancer			[ 12 ]
Location	Body (cg07948194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.84E-03; Z-score: -5.26E-01
Methylation in Case	9.42E-01 (Median)	Methylation in Control	9.47E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg14848594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.23E+00	Statistic Test	p-value: 5.25E-19; Z-score: 2.99E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 8.36E-18; Z-score: -3.61E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg24396691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.24E-16; Z-score: -2.33E+00
Methylation in Case	7.46E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg24933645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 3.84E-16; Z-score: 2.45E+00
Methylation in Case	8.47E-01 (Median)	Methylation in Control	5.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg26685195)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 5.63E-16; Z-score: -2.41E+00
Methylation in Case	5.01E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg07005353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 3.23E-03; Z-score: -4.77E-01
Methylation in Case	1.43E-01 (Median)	Methylation in Control	2.19E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC30A10 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg07948194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.06E-03; Z-score: 7.52E-01
Methylation in Case	6.70E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC30A10 in systemic lupus erythematosus			[ 14 ]
Location	1stExon (cg17721710)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.49E-02; Z-score: 9.81E-02
Methylation in Case	5.22E-02 (Median)	Methylation in Control	4.98E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC30A10 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.32E-27; Fold-change: 0.25594477; Z-score: 2.648567995
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC30A10 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.21E-11; Fold-change: 0.398873901; Z-score: 14.19373823
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	36 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-129 directly targets SLC30A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1303 directly targets SLC30A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1303	miRNA Mature ID	miR-1303
miRNA Sequence	UUUAGAGACGGGGUCUUGCUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1827 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1910 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1910	miRNA Mature ID	miR-1910-3p
miRNA Sequence	GAGGCAGAAGCAGGAUGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-26b directly targets SLC30A10			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 6	miR-29a directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29a	miRNA Mature ID	miR-29a-3p
miRNA Sequence	UAGCACCAUCUGAAAUCGGUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-29b directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29b	miRNA Mature ID	miR-29b-3p
miRNA Sequence	UAGCACCAUUUGAAAUCAGUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-29c directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29c	miRNA Mature ID	miR-29c-3p
miRNA Sequence	UAGCACCAUUUGAAAUCGGUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3189 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3189	miRNA Mature ID	miR-3189-3p
miRNA Sequence	CCCUUGGGUCUGAUGGGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-335 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-3p
miRNA Sequence	UUUUUCAUUAUUGCUCCUGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3612 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3612	miRNA Mature ID	miR-3612
miRNA Sequence	AGGAGGCAUCUUGAGAAAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3680 directly targets SLC30A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3680	miRNA Mature ID	miR-3680-3p
miRNA Sequence	UUUUGCAUGACCCUGGGAGUAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-3945 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3945	miRNA Mature ID	miR-3945
miRNA Sequence	AGGGCAUAGGAGAGGGUUGAUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4253 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4253	miRNA Mature ID	miR-4253
miRNA Sequence	AGGGCAUGUCCAGGGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4327 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4327	miRNA Mature ID	miR-4327
miRNA Sequence	GGCUUGCAUGGGGGACUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4424 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4424	miRNA Mature ID	miR-4424
miRNA Sequence	AGAGUUAACUCAAAAUGGACUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-450b directly targets SLC30A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-450b	miRNA Mature ID	miR-450b-5p
miRNA Sequence	UUUUGCAAUAUGUUCCUGAAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4537 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4537	miRNA Mature ID	miR-4537
miRNA Sequence	UGAGCCGAGCUGAGCUUAGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4539 directly targets SLC30A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4539	miRNA Mature ID	miR-4539
miRNA Sequence	GCUGAACUGGGCUGAGCUGGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-455 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-4695 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4695	miRNA Mature ID	miR-4695-5p
miRNA Sequence	CAGGAGGCAGUGGGCGAGCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-4724 directly targets SLC30A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4724	miRNA Mature ID	miR-4724-5p
miRNA Sequence	AACUGAACCAGGAGUGAGCUUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-507 directly targets SLC30A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-507	miRNA Mature ID	miR-507
miRNA Sequence	UUUUGCACCUUUUGGAGUGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-526b directly targets SLC30A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-5p
miRNA Sequence	CUCUUGAGGGAAGCACUUUCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-557 directly targets SLC30A10			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-557	miRNA Mature ID	miR-557
miRNA Sequence	GUUUGCACGGGUGGGCCUUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-5584 directly targets SLC30A10			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5584	miRNA Mature ID	miR-5584-3p
miRNA Sequence	UAGUUCUUCCCUUUGCCCAAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-5682 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5682	miRNA Mature ID	miR-5682
miRNA Sequence	GUAGCACCUUGCAGGAUAAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-635 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-635	miRNA Mature ID	miR-635
miRNA Sequence	ACUUGGGCACUGAAACAAUGUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-6499 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-650 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-650	miRNA Mature ID	miR-650
miRNA Sequence	AGGAGGCAGCGCUCUCAGGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-6516 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6516	miRNA Mature ID	miR-6516-5p
miRNA Sequence	UUUGCAGUAACAGGUGUGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-665 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-6774 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6774	miRNA Mature ID	miR-6774-5p
miRNA Sequence	ACUUGGGCAGGAGGGACCCUGUAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-6840 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6840	miRNA Mature ID	miR-6840-3p
miRNA Sequence	GCCCAGGACUUUGUGCGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-6862 directly targets SLC30A10			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6862	miRNA Mature ID	miR-6862-5p
miRNA Sequence	CGGGCAUGCUGGGAGAGACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6871 directly targets SLC30A10			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6871	miRNA Mature ID	miR-6871-3p
miRNA Sequence	CAGCACCCUGUGGCUCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
4	DNA Methylation Dynamics in Urological Tumors.
5	Genome-wide Scan for Methylation Profiles in Breast Cancer
6	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	Three DNA methylation epigenotypes in human colorectal cancer. Clin Cancer Res. 2010 Jan 1;16(1):21-33.
16	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
17	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
18	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
19	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
20	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence