Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0271 Transporter Info | ||||
Gene Name | SLC30A2 | ||||
Transporter Name | Zinc transporter 2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-335 directly targets SLC30A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-4731 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-5089 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-5589 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-619 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-6506 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-6511b directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6511b | miRNA Mature ID | miR-6511b-5p | ||
miRNA Sequence |
CUGCAGGCAGAAGUGGGGCUGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-6807 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-6811 directly targets SLC30A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6811 | miRNA Mature ID | miR-6811-5p | ||
miRNA Sequence |
AUGCAGGCCUGUGUACAGCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC30A2 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.004710753; Fold-change: -0.233822442; Z-score: -4.51954971 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC30A2 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.66E-17; Fold-change: -0.48886907; Z-score: -3.060494308 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC30A2 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.82E-19; Fold-change: -0.512642848; Z-score: -2.901886656 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC30A2 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.42E-18; Fold-change: -0.537220754; Z-score: -3.368046515 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Squamous cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC30A2 in squamous cell carcinoma than that in adjacent tissue | ||||
Studied Phenotype |
Squamous cell carcinoma [ICD-11:2B60] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 0.001646861; Fold-change: -0.211872199; Z-score: -2.568696763 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.