Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0272 Transporter Info
Gene Name SLC30A3
Transporter Name Zinc transporter 3
Gene ID
7781
UniProt ID
Q99726
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg00610991)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 2.28E-03; Z-score: 1.05E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg25313204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.13E-04; Z-score: -1.62E+00

Methylation in Case

 4.18E-01 (Median) Methylation in Control 4.91E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg16464328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.96E-04; Z-score: -2.07E+00

Methylation in Case

 5.24E-01 (Median) Methylation in Control 6.28E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 TSS200 (cg13509849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.46E+00 Statistic Test p-value: 3.77E-04; Z-score: 2.64E+00

Methylation in Case

 2.35E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 TSS200 (cg27320005)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.66E-03; Z-score: 7.57E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in colon adenocarcinoma [ 1 ]

Location

 Body (cg09153713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.20E-03; Z-score: -1.01E+00

Methylation in Case

 6.26E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg26857911)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 2.93E-12; Z-score: 6.95E-01

Methylation in Case

 3.03E-02 (Median) Methylation in Control 2.44E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 1stExon (cg06572160)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.76E+00 Statistic Test p-value: 1.08E-05; Z-score: -1.65E+00

Methylation in Case

 2.53E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 1stExon (cg01805869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.71E-02; Z-score: -3.68E-01

Methylation in Case

 3.13E-01 (Median) Methylation in Control 3.18E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg19130824)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 2.84E-20; Z-score: -2.74E+00

Methylation in Case

 6.47E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg19702785)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 1.28E-12; Z-score: 2.14E+00

Methylation in Case

 3.99E-01 (Median) Methylation in Control 3.03E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg10690829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 6.99E-04; Z-score: 9.91E-01

Methylation in Case

 7.27E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg04431596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 2.92E-03; Z-score: 8.05E-01

Methylation in Case

 6.48E-01 (Median) Methylation in Control 5.28E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC30A3 in pancretic ductal adenocarcinoma [ 2 ]

Location

 3'UTR (cg25161868)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.90E-05; Z-score: 1.40E+00

Methylation in Case

 8.05E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 TSS1500 (cg03875195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 9.07E-05; Z-score: 4.61E+00

Methylation in Case

 2.99E-01 (Median) Methylation in Control 2.24E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 TSS200 (cg10629682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.50E-03; Z-score: 2.46E+00

Methylation in Case

 2.19E-02 (Median) Methylation in Control 1.56E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.84E+00 Statistic Test p-value: 9.16E-11; Z-score: -9.01E+00

Methylation in Case

 2.31E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.18E+00 Statistic Test p-value: 2.51E-07; Z-score: 1.20E+01

Methylation in Case

 3.06E-01 (Median) Methylation in Control 9.63E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.14E-05; Z-score: -5.94E+00

Methylation in Case

 5.77E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 Body (cg23587288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 1.91E-03; Z-score: -2.36E+00

Methylation in Case

 6.52E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in bladder cancer [ 3 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 3.89E-08; Z-score: -6.49E+00

Methylation in Case

 2.76E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS1500 (cg03875195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 1.85E-09; Z-score: 2.36E+00

Methylation in Case

 4.02E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS1500 (cg24416973)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 2.27E-07; Z-score: 9.44E-01

Methylation in Case

 6.80E-02 (Median) Methylation in Control 5.44E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS1500 (cg18219563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 2.12E-06; Z-score: 9.85E-01

Methylation in Case

 6.99E-02 (Median) Methylation in Control 5.36E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS1500 (cg02915746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 7.47E-04; Z-score: 3.57E-01

Methylation in Case

 5.84E-02 (Median) Methylation in Control 5.16E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS1500 (cg13875111)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.02E-03; Z-score: 1.30E-01

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 TSS200 (cg10629682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 1.28E-02; Z-score: 8.07E-01

Methylation in Case

 1.84E-02 (Median) Methylation in Control 1.37E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.83E-15; Z-score: -2.53E+00

Methylation in Case

 4.18E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 Body (cg20885815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 6.03E-11; Z-score: 2.07E+00

Methylation in Case

 6.76E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.24E+00 Statistic Test p-value: 2.76E-09; Z-score: 1.66E+00

Methylation in Case

 1.92E-01 (Median) Methylation in Control 8.55E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.92E-04; Z-score: -8.75E-01

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC30A3 in breast cancer [ 4 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.91E-06; Z-score: -1.23E+00

Methylation in Case

 4.88E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg18219563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.76E-04; Z-score: 1.32E-01

Methylation in Case

 5.69E-02 (Median) Methylation in Control 5.52E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg02915746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 1.55E-02; Z-score: 1.40E+00

Methylation in Case

 2.55E-02 (Median) Methylation in Control 1.78E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg23587288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.90E-04; Z-score: -1.25E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.13E-03; Z-score: 5.18E-01

Methylation in Case

 6.49E-02 (Median) Methylation in Control 5.59E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.47E-02; Z-score: -9.22E-02

Methylation in Case

 9.33E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in clear cell renal cell carcinoma [ 5 ]

Location

 Body (cg11226148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.81E-02; Z-score: 2.03E-01

Methylation in Case

 7.52E-02 (Median) Methylation in Control 7.18E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg24416973)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.65E+00 Statistic Test p-value: 1.01E-06; Z-score: 2.33E+00

Methylation in Case

 5.94E-02 (Median) Methylation in Control 3.59E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg02915746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 5.18E-06; Z-score: 5.12E-01

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg13875111)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.03E-04; Z-score: 7.51E-01

Methylation in Case

 1.96E-01 (Median) Methylation in Control 1.78E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg18219563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 5.35E-04; Z-score: 8.92E-01

Methylation in Case

 3.49E-02 (Median) Methylation in Control 2.90E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg03875195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 6.40E-03; Z-score: 8.39E-01

Methylation in Case

 5.21E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS200 (cg10629682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.13E-03; Z-score: 1.07E+00

Methylation in Case

 1.64E-02 (Median) Methylation in Control 1.27E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS200 (cg13174651)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.38E-03; Z-score: -5.88E-02

Methylation in Case

 1.79E-02 (Median) Methylation in Control 1.82E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS200 (cg01878321)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.51E-02; Z-score: 3.16E-01

Methylation in Case

 1.41E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 TSS200 (cg03023068)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.16E-02; Z-score: -9.70E-02

Methylation in Case

 3.88E-02 (Median) Methylation in Control 4.10E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 5.02E+00 Statistic Test p-value: 8.74E-18; Z-score: 1.00E+01

Methylation in Case

 4.36E-01 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 Body (cg11226148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.80E+00 Statistic Test p-value: 9.50E-10; Z-score: 3.28E+00

Methylation in Case

 2.51E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.44E-04; Z-score: -9.98E-01

Methylation in Case

 4.63E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.44E-04; Z-score: -4.18E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC30A3 in colorectal cancer [ 6 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.67E-02; Z-score: -8.48E-01

Methylation in Case

 5.10E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg24416973)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.57E+00 Statistic Test p-value: 1.19E-06; Z-score: 1.92E+00

Methylation in Case

 1.18E-01 (Median) Methylation in Control 7.54E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg03875195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 2.95E-05; Z-score: 2.90E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 3.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg18219563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 9.68E-05; Z-score: 4.47E-01

Methylation in Case

 9.07E-02 (Median) Methylation in Control 7.59E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg02915746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.04E-03; Z-score: 1.54E-01

Methylation in Case

 8.04E-02 (Median) Methylation in Control 7.70E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg10629682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.48E-02; Z-score: 7.24E-02

Methylation in Case

 2.35E-02 (Median) Methylation in Control 2.27E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.22E-07; Z-score: -1.85E+00

Methylation in Case

 3.87E-01 (Median) Methylation in Control 4.74E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.52E-05; Z-score: -6.91E-01

Methylation in Case

 7.70E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg23587288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.05E-05; Z-score: -1.08E+00

Methylation in Case

 7.87E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg11226148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.49E-04; Z-score: 3.52E-01

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 3'UTR (cg04223222)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 3.66E-18; Z-score: -1.04E+01

Methylation in Case

 5.35E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC30A3 in hepatocellular carcinoma [ 7 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.85E-04; Z-score: -1.49E+00

Methylation in Case

 3.77E-01 (Median) Methylation in Control 4.59E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 TSS1500 (cg24416973)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 1.72E-04; Z-score: 1.25E+00

Methylation in Case

 5.16E-02 (Median) Methylation in Control 3.81E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 TSS1500 (cg18219563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.56E-02; Z-score: 6.98E-01

Methylation in Case

 5.08E-02 (Median) Methylation in Control 4.28E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 TSS1500 (cg02915746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.97E-02; Z-score: 6.16E-01

Methylation in Case

 7.17E-02 (Median) Methylation in Control 6.01E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 TSS200 (cg03023068)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 3.44E-03; Z-score: 8.44E-01

Methylation in Case

 1.40E-01 (Median) Methylation in Control 9.74E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 TSS200 (cg13174651)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 3.73E-02; Z-score: 6.97E-01

Methylation in Case

 3.23E-02 (Median) Methylation in Control 2.51E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.62E-05; Z-score: -1.12E+00

Methylation in Case

 4.89E-01 (Median) Methylation in Control 5.31E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC30A3 in HIV infection [ 8 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 2.13E-05; Z-score: -1.72E+00

Methylation in Case

 6.41E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in prostate cancer [ 9 ]

Location

 TSS1500 (cg12175729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.23E+00 Statistic Test p-value: 3.43E-02; Z-score: 1.33E+01

Methylation in Case

 2.68E-01 (Median) Methylation in Control 6.34E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in prostate cancer [ 9 ]

Location

 TSS200 (cg01325409)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.15E-02; Z-score: -8.13E+00

Methylation in Case

 6.98E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in prostate cancer [ 9 ]

Location

 TSS200 (cg11962947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 3.19E-02; Z-score: 1.96E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 7.24E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in prostate cancer [ 9 ]

Location

 Body (cg19490609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 8.19E-03; Z-score: 2.85E+00

Methylation in Case

 6.39E-01 (Median) Methylation in Control 5.39E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Depression

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in depression [ 10 ]

Location

 TSS200 (cg23151303)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.07E-02; Z-score: -4.06E-01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in depression [ 10 ]

Location

 Body (cg23587288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.32E-02; Z-score: 3.93E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in papillary thyroid cancer [ 11 ]

Location

 TSS200 (cg10629682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 8.88E-03; Z-score: -5.31E-01

Methylation in Case

 5.58E-02 (Median) Methylation in Control 5.97E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg20885815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.46E-03; Z-score: 1.11E+00

Methylation in Case

 6.31E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.60E-03; Z-score: 8.87E-01

Methylation in Case

 8.25E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg11226148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 7.17E-03; Z-score: -6.93E-01

Methylation in Case

 1.13E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.12E-05; Z-score: -3.46E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 7.87E-03; Z-score: 7.74E-01

Methylation in Case

 7.91E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg11226148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.06E-02; Z-score: -4.35E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A3 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 1.58E-09; Z-score: -1.58E+00

Methylation in Case

 5.80E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in lung adenocarcinoma [ 13 ]

Location

 Body (cg20885815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 3.98E-05; Z-score: 3.24E+00

Methylation in Case

 7.42E-01 (Median) Methylation in Control 5.61E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in lung adenocarcinoma [ 13 ]

Location

 Body (cg08789022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.50E+00 Statistic Test p-value: 4.10E-03; Z-score: 3.44E+00

Methylation in Case

 3.39E-01 (Median) Methylation in Control 9.69E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in panic disorder [ 14 ]

Location

 Body (cg20885815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 2.96E-02; Z-score: 1.70E-01

Methylation in Case

 2.20E+00 (Median) Methylation in Control 2.12E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in panic disorder [ 14 ]

Location

 Body (cg17206420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.18E+00 Statistic Test p-value: 3.39E-02; Z-score: 3.17E-01

Methylation in Case

 1.17E-01 (Median) Methylation in Control 3.69E-02 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A3 in panic disorder [ 14 ]

Location

 3'UTR (cg24594459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.27E-02; Z-score: 4.23E-01

Methylation in Case

 1.24E+00 (Median) Methylation in Control 1.07E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A3 in systemic lupus erythematosus [ 15 ]

Location

 Body (cg00303811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.92E-02; Z-score: -1.64E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A3 in systemic lupus erythematosus [ 15 ]

Location

 Body (cg23587288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.21E-02; Z-score: -2.87E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          20 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1184 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1184 miRNA Mature ID miR-1184

miRNA Sequence

 CCUGCAGCGACUUGAUGGCUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1289 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1289 miRNA Mature ID miR-1289

miRNA Sequence

 UGGAGUCCAGGAAUCUGCAUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-130b directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-5p

miRNA Sequence

 ACUCUUUCCCUGUUGCACUAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-140 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-140 miRNA Mature ID miR-140-3p

miRNA Sequence

 UACCACAGGGUAGAACCACGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-211 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-211 miRNA Mature ID miR-211-3p

miRNA Sequence

 GCAGGGACAGCAAAGGGGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-2276 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2276 miRNA Mature ID miR-2276-5p

miRNA Sequence

 GCCCUCUGUCACCUUGCAGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-3127 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3127 miRNA Mature ID miR-3127-5p

miRNA Sequence

 AUCAGGGCUUGUGGAAUGGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4270 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

 UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4441 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

 ACAGGGAGGAGAUUGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4469 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-497 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-3p

miRNA Sequence

 CAAACCACACUGUGGUGUUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-548aa directly targets SLC30A3 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 13

 miR-548ap directly targets SLC30A3 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

 AAAAACCACAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 14

 miR-548t directly targets SLC30A3 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 15

 miR-642a directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-642a miRNA Mature ID miR-642a-5p

miRNA Sequence

 GUCCCUCUCCAAAUGUGUCUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-6749 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6749 miRNA Mature ID miR-6749-3p

miRNA Sequence

 CUCCUCCCCUGCCUGGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-6754 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

 CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-6892 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-7846 directly targets SLC30A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7846 miRNA Mature ID miR-7846-3p

miRNA Sequence

 CAGCGGAGCCUGGAGAGAAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-8485 directly targets SLC30A3 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
17 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.