Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0275 Transporter Info
Gene Name SLC30A6
Transporter Name Zinc transporter 6
Gene ID
55676
UniProt ID
Q6NXT4
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in breast cancer [ 1 ]

Location

 TSS1500 (cg17867194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.07E-02; Z-score: -1.93E-01

Methylation in Case

 4.96E-02 (Median) Methylation in Control 5.30E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS1500 (cg22726039)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 9.95E-03; Z-score: 5.73E-01

Methylation in Case

 1.50E-02 (Median) Methylation in Control 1.33E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg17867194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.14E-05; Z-score: 9.67E-01

Methylation in Case

 9.61E-02 (Median) Methylation in Control 8.49E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A6 in colorectal cancer [ 3 ]

Location

 TSS200 (cg04270736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.29E-02; Z-score: -4.96E-01

Methylation in Case

 8.40E-02 (Median) Methylation in Control 9.27E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A6 in colorectal cancer [ 3 ]

Location

 Body (cg22548000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.19E-02; Z-score: -3.00E-01

Methylation in Case

 8.83E-02 (Median) Methylation in Control 9.92E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Panic disorder

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in panic disorder [ 4 ]

Location

 TSS1500 (cg22726039)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.70E-01 Statistic Test p-value: 1.22E-03; Z-score: 6.00E-01

Methylation in Case

 -5.00E+00 (Median) Methylation in Control -5.15E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A6 in panic disorder [ 4 ]

Location

 TSS1500 (cg17867194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.85E-01 Statistic Test p-value: 1.42E-02; Z-score: 2.73E-01

Methylation in Case

 -4.62E+00 (Median) Methylation in Control -4.69E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A6 in panic disorder [ 4 ]

Location

 Body (cg02613156)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.74E-04; Z-score: -6.96E-01

Methylation in Case

 2.31E+00 (Median) Methylation in Control 2.59E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A6 in panic disorder [ 4 ]

Location

 3'UTR (cg10277836)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.64E-02; Z-score: -1.83E-01

Methylation in Case

 1.55E-01 (Median) Methylation in Control 2.02E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in papillary thyroid cancer [ 5 ]

Location

 TSS1500 (cg22726039)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.44E-04; Z-score: -6.39E-01

Methylation in Case

 4.18E-02 (Median) Methylation in Control 4.71E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A6 in papillary thyroid cancer [ 5 ]

Location

 TSS200 (cg04270736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.28E-02; Z-score: -2.49E-01

Methylation in Case

 4.49E-02 (Median) Methylation in Control 4.69E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A6 in papillary thyroid cancer [ 5 ]

Location

 TSS200 (cg04522455)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.67E-02; Z-score: -3.74E-01

Methylation in Case

 6.12E-02 (Median) Methylation in Control 6.35E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC30A6 in papillary thyroid cancer [ 5 ]

Location

 Body (cg22548000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.72E-05; Z-score: -5.00E-01

Methylation in Case

 5.06E-02 (Median) Methylation in Control 5.78E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC30A6 in papillary thyroid cancer [ 5 ]

Location

 Body (cg02613156)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.84E-02; Z-score: 3.73E-01

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in systemic lupus erythematosus [ 6 ]

Location

 TSS1500 (cg17867194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.09E-02; Z-score: -7.85E-02

Methylation in Case

 7.29E-02 (Median) Methylation in Control 7.43E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A6 in systemic lupus erythematosus [ 6 ]

Location

 Body (cg22548000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.27E-02; Z-score: -1.75E-01

Methylation in Case

 6.28E-02 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg02613156)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.86E-04; Z-score: -7.31E-01

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC30A6 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg09469033)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.06E-02; Z-score: 5.04E-01

Methylation in Case

 8.27E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC30A6 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 3'UTR (cg10277836)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 2.91E-12; Z-score: 1.73E+00

Methylation in Case

 7.84E-01 (Median) Methylation in Control 6.13E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in colon adenocarcinoma [ 8 ]

Location

 Body (cg03807914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.55E-03; Z-score: -1.82E+00

Methylation in Case

 8.06E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC30A6 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg04350355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 6.67E-03; Z-score: -7.99E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          41 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7d directly targets SLC30A6 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-1250 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1250 miRNA Mature ID miR-1250-3p

miRNA Sequence

 ACAUUUUCCAGCCCAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-142 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

 UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-153 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-153 miRNA Mature ID miR-153-5p

miRNA Sequence

 UCAUUUUUGUGAUGUUGCAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-15b directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-3p

miRNA Sequence

 CGAAUCAUUAUUUGCUGCUCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1827 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

 UGAGGCAGUAGAUUGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-196a directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

 UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-196b directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-196b miRNA Mature ID miR-196b-5p

miRNA Sequence

 UAGGUAGUUUCCUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-199a directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-199a miRNA Mature ID miR-199a-3p

miRNA Sequence

 ACAGUAGUCUGCACAUUGGUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-199b directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-199b miRNA Mature ID miR-199b-3p

miRNA Sequence

 ACAGUAGUCUGCACAUUGGUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-203b directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-203b miRNA Mature ID miR-203b-3p

miRNA Sequence

 UUGAACUGUUAAGAACCACUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-2355 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2355 miRNA Mature ID miR-2355-5p

miRNA Sequence

 AUCCCCAGAUACAAUGGACAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3129 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3129 miRNA Mature ID miR-3129-5p

miRNA Sequence

 GCAGUAGUGUAGAGAUUGGUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-3679 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3679 miRNA Mature ID miR-3679-3p

miRNA Sequence

 CUUCCCCCCAGUAAUCUUCAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-374b directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-374b miRNA Mature ID miR-374b-3p

miRNA Sequence

 CUUAGCAGGUUGUAUUAUCAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-382 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-382 miRNA Mature ID miR-382-3p

miRNA Sequence

 AAUCAUUCACGGACAACACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-3929 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

 GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-423 directly targets SLC30A6 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-3p

miRNA Sequence

 AGCUCGGUCUGAGGCCCCUCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-4280 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4280 miRNA Mature ID miR-4280

miRNA Sequence

 GAGUGUAGUUCUGAGCAGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-4446 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4446 miRNA Mature ID miR-4446-5p

miRNA Sequence

 AUUUCCCUGCCAUUCCCUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4478 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

 GAGGCUGAGCUGAGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-4649 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

 UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-4680 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4680 miRNA Mature ID miR-4680-5p

miRNA Sequence

 AGAACUCUUGCAGUCUUAGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4722 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

 GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-4742 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4742 miRNA Mature ID miR-4742-3p

miRNA Sequence

 UCUGUAUUCUCCUUUGCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-4761 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4761 miRNA Mature ID miR-4761-5p

miRNA Sequence

 ACAAGGUGUGCAUGCCUGACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-4768 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-485 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-4999 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4999 miRNA Mature ID miR-4999-5p

miRNA Sequence

 UGCUGUAUUGUCAGGUAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-579 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-579 miRNA Mature ID miR-579-3p

miRNA Sequence

 UUCAUUUGGUAUAAACCGCGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-664b directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-664b miRNA Mature ID miR-664b-3p

miRNA Sequence

 UUCAUUUGCCUCCCAGCCUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-665 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-6746 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6746 miRNA Mature ID miR-6746-5p

miRNA Sequence

 CCGGGAGAAGGAGGUGGCCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-6771 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6771 miRNA Mature ID miR-6771-5p

miRNA Sequence

 CUCGGGAGGGCAUGGGCCAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-6806 directly targets SLC30A6 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6806 miRNA Mature ID miR-6806-5p

miRNA Sequence

 UGUAGGCAUGAGGCAGGGCCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-6808 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

 CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-6884 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

 AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-6893 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

 CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-7158 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7158 miRNA Mature ID miR-7158-3p

miRNA Sequence

 CUGAACUAGAGAUUGGGCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-7160 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

 UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-940 directly targets SLC30A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-940 miRNA Mature ID miR-940

miRNA Sequence

 AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
11 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.