Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0278 Transporter Info | ||||
Gene Name | SLC31A1 | ||||
Transporter Name | High affinity copper uptake protein 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC31A1 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
Location |
5'UTR (cg14451627) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 8.58E-07; Z-score: 1.36E+00 | ||
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC31A1 in bladder cancer | [ 2 ] | |||
Location |
5'UTR (cg14451627) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.21E-02; Z-score: -2.59E+00 | ||
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC31A1 in hepatocellular carcinoma | [ 3 ] | |||
Location |
5'UTR (cg14451627) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 8.96E-03; Z-score: -3.10E-01 | ||
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
54 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-122 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1237 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1237 | miRNA Mature ID | miR-1237-3p | ||
miRNA Sequence |
UCCUUCUGCUCCGUCCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-124 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-1260a directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1260a | miRNA Mature ID | miR-1260a | ||
miRNA Sequence |
AUCCCACCUCUGCCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-1260b directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-1297 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1297 | miRNA Mature ID | miR-1297 | ||
miRNA Sequence |
UUCAAGUAAUUCAGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-130a directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-130a | miRNA Mature ID | miR-130a-3p | ||
miRNA Sequence |
CAGUGCAAUGUUAAAAGGGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-130b directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-130b | miRNA Mature ID | miR-130b-3p | ||
miRNA Sequence |
CAGUGCAAUGAUGAAAGGGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-183 directly targets SLC31A1 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-183 | miRNA Mature ID | miR-183-5p | ||
miRNA Sequence |
UAUGGCACUGGUAGAAUUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-185 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-188 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-188 | miRNA Mature ID | miR-188-3p | ||
miRNA Sequence |
CUCCCACAUGCAGGGUUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-1976 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-21 directly targets SLC31A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-21 | miRNA Mature ID | miR-21-5p | ||
miRNA Sequence |
UAGCUUAUCAGACUGAUGUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 14 |
miR-26a directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-26a | miRNA Mature ID | miR-26a-5p | ||
miRNA Sequence |
UUCAAGUAAUCCAGGAUAGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-26b directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-301a directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-301a | miRNA Mature ID | miR-301a-3p | ||
miRNA Sequence |
CAGUGCAAUAGUAUUGUCAAAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-301b directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-301b | miRNA Mature ID | miR-301b-3p | ||
miRNA Sequence |
CAGUGCAAUGAUAUUGUCAAAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-3123 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3123 | miRNA Mature ID | miR-3123 | ||
miRNA Sequence |
CAGAGAAUUGUUUAAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-3156 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3156 | miRNA Mature ID | miR-3156-3p | ||
miRNA Sequence |
CUCCCACUUCCAGAUCUUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-3177 directly targets SLC31A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3177 | miRNA Mature ID | miR-3177-5p | ||
miRNA Sequence |
UGUGUACACACGUGCCAGGCGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 21 |
miR-3614 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-3p | ||
miRNA Sequence |
UAGCCUUCAGAUCUUGGUGUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-3650 directly targets SLC31A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3650 | miRNA Mature ID | miR-3650 | ||
miRNA Sequence |
AGGUGUGUCUGUAGAGUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 23 |
miR-3666 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3666 | miRNA Mature ID | miR-3666 | ||
miRNA Sequence |
CAGUGCAAGUGUAGAUGCCGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-3925 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3925 | miRNA Mature ID | miR-3925-5p | ||
miRNA Sequence |
AAGAGAACUGAAAGUGGAGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 25 |
miR-4279 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-4295 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4295 | miRNA Mature ID | miR-4295 | ||
miRNA Sequence |
CAGUGCAAUGUUUUCCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-4301 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4301 | miRNA Mature ID | miR-4301 | ||
miRNA Sequence |
UCCCACUACUUCACUUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 28 |
miR-4306 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-4465 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4465 | miRNA Mature ID | miR-4465 | ||
miRNA Sequence |
CUCAAGUAGUCUGACCAGGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-454 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-454 | miRNA Mature ID | miR-454-3p | ||
miRNA Sequence |
UAGUGCAAUAUUGCUUAUAGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-4682 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4682 | miRNA Mature ID | miR-4682 | ||
miRNA Sequence |
UCUGAGUUCCUGGAGCCUGGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-4722 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-500b directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-518d directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-518d | miRNA Mature ID | miR-518d-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCACUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 35 |
miR-518e directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-518e | miRNA Mature ID | miR-518e-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-518f directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-518f | miRNA Mature ID | miR-518f-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCACUUUCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 37 |
miR-519a directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-519a | miRNA Mature ID | miR-519a-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-519b directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-519b | miRNA Mature ID | miR-519b-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 39 |
miR-519c directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-519c | miRNA Mature ID | miR-519c-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-520c directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520c | miRNA Mature ID | miR-520c-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCACUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 41 |
miR-520g directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-5p | ||
miRNA Sequence |
UCUAGAGGAAGCACUUUCUGUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 42 |
miR-522 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-522 | miRNA Mature ID | miR-522-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-523 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-523 | miRNA Mature ID | miR-523-5p | ||
miRNA Sequence |
CUCUAGAGGGAAGCGCUUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 44 |
miR-548an directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548an | miRNA Mature ID | miR-548an | ||
miRNA Sequence |
AAAAGGCAUUGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 45 |
miR-5571 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5571 | miRNA Mature ID | miR-5571-3p | ||
miRNA Sequence |
GUCCUAGGAGGCUCCUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 46 |
miR-5582 directly targets SLC31A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5582 | miRNA Mature ID | miR-5582-5p | ||
miRNA Sequence |
UAGGCACACUUAAAGUUAUAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-574 directly targets SLC31A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 48 |
miR-6513 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6513 | miRNA Mature ID | miR-6513-3p | ||
miRNA Sequence |
UCAAGUGUCAUCUGUCCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 49 |
miR-652 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-652 | miRNA Mature ID | miR-652-3p | ||
miRNA Sequence |
AAUGGCGCCACUAGGGUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 50 |
miR-6727 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 51 |
miR-6747 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 52 |
miR-6867 directly targets SLC31A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 53 |
miR-6869 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6869 | miRNA Mature ID | miR-6869-5p | ||
miRNA Sequence |
GUGAGUAGUGGCGCGCGGCGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 54 |
miR-8062 directly targets SLC31A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8062 | miRNA Mature ID | miR-8062 | ||
miRNA Sequence |
CAGUGAUUUGAGGAUUAUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.