Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0280 Transporter Info
Gene Name SLC31A2
Transporter Name Probable low affinity copper uptake protein 2
Gene ID
1318
UniProt ID
O15432
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in bladder cancer [ 1 ]

Location

 TSS1500 (cg05706061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 1.09E-02; Z-score: -1.46E+00

Methylation in Case

 1.54E-01 (Median) Methylation in Control 2.10E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in bladder cancer [ 1 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 4.58E-05; Z-score: -4.25E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in bladder cancer [ 1 ]

Location

 Body (cg14537179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.42E-04; Z-score: -5.48E+00

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC31A2 in bladder cancer [ 1 ]

Location

 Body (cg23583420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 3.60E-02; Z-score: -1.74E+00

Methylation in Case

 3.70E-02 (Median) Methylation in Control 4.85E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in hepatocellular carcinoma [ 2 ]

Location

 TSS1500 (cg05706061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 6.83E-06; Z-score: -1.07E+00

Methylation in Case

 3.72E-01 (Median) Methylation in Control 4.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in hepatocellular carcinoma [ 2 ]

Location

 TSS1500 (cg14485581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.55E-04; Z-score: -7.59E-01

Methylation in Case

 8.04E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg01939522)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 9.29E-15; Z-score: -8.70E+00

Methylation in Case

 6.12E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC31A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg14361947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 2.78E-10; Z-score: -2.45E+00

Methylation in Case

 3.04E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in HIV infection [ 3 ]

Location

 TSS1500 (cg05706061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.77E-03; Z-score: 6.71E-01

Methylation in Case

 5.38E-01 (Median) Methylation in Control 5.02E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in HIV infection [ 3 ]

Location

 Body (cg06252382)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.94E+00 Statistic Test p-value: 2.34E-04; Z-score: 1.05E+00

Methylation in Case

 1.52E-02 (Median) Methylation in Control 7.85E-03 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in HIV infection [ 3 ]

Location

 Body (cg13836270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 3.26E-03; Z-score: 1.01E+00

Methylation in Case

 4.06E-02 (Median) Methylation in Control 2.64E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg05706061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.12E-02; Z-score: 1.04E+00

Methylation in Case

 4.31E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in lung adenocarcinoma [ 4 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.14E-02; Z-score: -1.70E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in systemic lupus erythematosus [ 5 ]

Location

 TSS1500 (cg14485581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.16E-03; Z-score: -1.28E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in systemic lupus erythematosus [ 5 ]

Location

 Body (cg13836270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.61E-03; Z-score: 1.18E-01

Methylation in Case

 2.42E-02 (Median) Methylation in Control 2.32E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 1stExon (cg10778619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.15E-07; Z-score: 2.72E-01

Methylation in Case

 8.52E-02 (Median) Methylation in Control 8.05E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg09407223)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 3.62E-17; Z-score: -3.01E+00

Methylation in Case

 4.24E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg19262958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.03E-04; Z-score: 9.32E-01

Methylation in Case

 8.03E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg06252382)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.26E-03; Z-score: -9.28E-01

Methylation in Case

 4.91E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.90E-02; Z-score: 1.07E-01

Methylation in Case

 8.08E-02 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg13836270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.92E-02; Z-score: -6.39E-01

Methylation in Case

 5.16E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC31A2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg14537179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 4.72E-02; Z-score: -7.18E-01

Methylation in Case

 7.75E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in breast cancer [ 8 ]

Location

 Body (cg14537179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.45E-07; Z-score: -1.30E+00

Methylation in Case

 8.38E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in breast cancer [ 8 ]

Location

 Body (cg13836270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 5.45E-05; Z-score: 6.28E-01

Methylation in Case

 2.28E-02 (Median) Methylation in Control 1.79E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in breast cancer [ 8 ]

Location

 Body (cg06252382)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 2.00E-03; Z-score: 5.45E-01

Methylation in Case

 9.35E-03 (Median) Methylation in Control 6.44E-03 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in colorectal cancer [ 9 ]

Location

 Body (cg14537179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.54E-07; Z-score: -2.14E+00

Methylation in Case

 9.10E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in colorectal cancer [ 9 ]

Location

 Body (cg06252382)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 1.14E-03; Z-score: 1.41E+00

Methylation in Case

 1.80E-02 (Median) Methylation in Control 1.26E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC31A2 in colorectal cancer [ 9 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.12E-02; Z-score: -6.98E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC31A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.20E-04; Z-score: -5.63E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC31A2 in papillary thyroid cancer [ 10 ]

Location

 Body (cg06252382)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 9.53E-03; Z-score: -4.58E-01

Methylation in Case

 4.91E-02 (Median) Methylation in Control 5.25E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets SLC31A2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.