Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0291 Transporter Info
Gene Name SLC35A5
Transporter Name Probable UDP-sugar transporter protein SLC35A5
Gene ID
55032
UniProt ID
Q9BS91
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in bladder cancer [ 1 ]

Location

 5'UTR (cg03599590)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.18E+00 Statistic Test p-value: 2.39E-11; Z-score: -9.83E+00

Methylation in Case

 7.70E-02 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in bladder cancer [ 1 ]

Location

 Body (cg01443337)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 8.57E-08; Z-score: -1.82E+01

Methylation in Case

 5.07E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35A5 in bladder cancer [ 1 ]

Location

 3'UTR (cg25707238)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.51E-02; Z-score: -8.28E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in breast cancer [ 2 ]

Location

 5'UTR (cg03599590)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 2.41E-06; Z-score: -2.52E+00

Methylation in Case

 1.33E-01 (Median) Methylation in Control 2.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in breast cancer [ 2 ]

Location

 Body (cg01443337)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.17E-03; Z-score: -2.38E-02

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35A5 in breast cancer [ 2 ]

Location

 3'UTR (cg25707238)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.53E-04; Z-score: -9.16E-01

Methylation in Case

 8.25E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in hepatocellular carcinoma [ 3 ]

Location

 5'UTR (cg03599590)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.86E-02; Z-score: -1.09E+00

Methylation in Case

 1.42E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg14413177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 1.29E-15; Z-score: -2.26E+00

Methylation in Case

 3.26E-01 (Median) Methylation in Control 4.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35A5 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg24855956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 2.69E-10; Z-score: -4.22E+00

Methylation in Case

 5.79E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in lung adenocarcinoma [ 4 ]

Location

 5'UTR (cg03599590)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 4.11E-02; Z-score: -7.78E-01

Methylation in Case

 2.76E-01 (Median) Methylation in Control 3.16E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in lung adenocarcinoma [ 4 ]

Location

 3'UTR (cg25707238)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.96E-03; Z-score: -1.25E+00

Methylation in Case

 8.46E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in papillary thyroid cancer [ 5 ]

Location

 5'UTR (cg03599590)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 1.23E-07; Z-score: -1.13E+00

Methylation in Case

 1.72E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in papillary thyroid cancer [ 5 ]

Location

 Body (cg09473763)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.10E-04; Z-score: -7.99E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg21088438)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 1.55E-06; Z-score: -1.45E+00

Methylation in Case

 5.27E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35A5 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS200 (cg25353142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 6.09E-12; Z-score: -1.61E+00

Methylation in Case

 2.01E-01 (Median) Methylation in Control 2.66E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35A5 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg16397021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 7.81E-05; Z-score: 1.26E+00

Methylation in Case

 8.41E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A5 in colorectal cancer [ 7 ]

Location

 3'UTR (cg25707238)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.90E-02; Z-score: 3.36E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-3p

miRNA Sequence

 CUAUACAAUCUACUGUCUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7b directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-3p

miRNA Sequence

 CUAUACAACCUACUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7f-1 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f-1 miRNA Mature ID let-7f-1-3p

miRNA Sequence

 CUAUACAAUCUAUUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-1 directly targets SLC35A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 5

 miR-300 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-300 miRNA Mature ID miR-300

miRNA Sequence

 UAUACAAGGGCAGACUCUCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-3129 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3129 miRNA Mature ID miR-3129-3p

miRNA Sequence

 AAACUAAUCUCUACACUGCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-335 directly targets SLC35A5 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-338 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-338 miRNA Mature ID miR-338-5p

miRNA Sequence

 AACAAUAUCCUGGUGCUGAGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-381 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

 UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-4666a directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4666a miRNA Mature ID miR-4666a-3p

miRNA Sequence

 CAUACAAUCUGACAUGUAUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-558 directly targets SLC35A5 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-558 miRNA Mature ID miR-558

miRNA Sequence

 UGAGCUGCUGUACCAAAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-5583 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5583 miRNA Mature ID miR-5583-5p

miRNA Sequence

 AAACUAAUAUACCCAUAUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-7 directly targets SLC35A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

 UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-802 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-802 miRNA Mature ID miR-802

miRNA Sequence

 CAGUAACAAAGAUUCAUCCUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-98 directly targets SLC35A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-3p

miRNA Sequence

 CUAUACAACUUACUACUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
9 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 Regulation of epidermal growth factor receptor signaling in human cancer cells by microRNA-7. J Biol Chem. 2009 Feb 27;284(9):5731-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.