Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0292 Transporter Info
Gene Name SLC35B1
Transporter Name UDP-galactose transporter-related protein 1
Gene ID
10237
UniProt ID
P78383
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg16029760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.05E+00 Statistic Test p-value: 1.36E-19; Z-score: 3.62E+00

Methylation in Case

 4.97E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg07629187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.28E+00 Statistic Test p-value: 1.11E-09; Z-score: 4.85E+00

Methylation in Case

 1.71E-01 (Median) Methylation in Control 7.52E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg06375292)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.43E-05; Z-score: -9.15E-01

Methylation in Case

 6.35E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

 TSS200 (cg26417642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.08E+00 Statistic Test p-value: 6.92E-10; Z-score: 5.10E+00

Methylation in Case

 9.23E-02 (Median) Methylation in Control 2.26E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg15889012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 7.01E-12; Z-score: 1.93E+00

Methylation in Case

 4.83E-01 (Median) Methylation in Control 3.38E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in breast cancer [ 2 ]

Location

 TSS1500 (cg23576473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 7.90E-03; Z-score: -3.94E-01

Methylation in Case

 2.67E-02 (Median) Methylation in Control 3.29E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg06016431)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.81E-03; Z-score: -3.68E-01

Methylation in Case

 7.29E-02 (Median) Methylation in Control 8.23E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg23576473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.28E-02; Z-score: -3.29E-01

Methylation in Case

 5.34E-02 (Median) Methylation in Control 5.82E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

 TSS200 (cg00909976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 7.72E-03; Z-score: 5.06E-01

Methylation in Case

 2.12E-02 (Median) Methylation in Control 1.90E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

 Body (cg27658080)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.20E-02; Z-score: -4.65E-01

Methylation in Case

 8.34E-02 (Median) Methylation in Control 9.13E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg23576473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.68E-03; Z-score: 2.03E+00

Methylation in Case

 6.25E-02 (Median) Methylation in Control 5.35E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg06016431)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.59E-02; Z-score: 7.25E-01

Methylation in Case

 7.25E-02 (Median) Methylation in Control 6.94E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg06375292)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.81E-02; Z-score: 9.58E-01

Methylation in Case

 6.52E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

 TSS200 (cg01650744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.75E-02; Z-score: 1.02E+00

Methylation in Case

 6.76E-02 (Median) Methylation in Control 6.02E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in pancretic ductal adenocarcinoma [ 5 ]

Location

 TSS1500 (cg25185710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.52E-03; Z-score: -5.90E-01

Methylation in Case

 1.33E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in panic disorder [ 6 ]

Location

 TSS1500 (cg06375292)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.62E-02; Z-score: 2.44E-01

Methylation in Case

 2.60E+00 (Median) Methylation in Control 2.50E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg23576473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.44E-02; Z-score: -2.22E-01

Methylation in Case

 2.75E-02 (Median) Methylation in Control 2.92E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35B1 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg00909976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.75E-02; Z-score: -2.40E-01

Methylation in Case

 6.33E-02 (Median) Methylation in Control 6.49E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

 TSS200 (cg00909976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 4.09E-02; Z-score: -1.32E+00

Methylation in Case

 3.27E-02 (Median) Methylation in Control 4.51E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

 TSS200 (cg01650744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 4.78E-02; Z-score: -1.89E+00

Methylation in Case

 4.07E-02 (Median) Methylation in Control 4.89E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

 Body (cg27658080)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 4.01E-02; Z-score: -1.35E+00

Methylation in Case

 4.59E-02 (Median) Methylation in Control 5.06E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1236 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1236 miRNA Mature ID miR-1236-3p

miRNA Sequence

 CCUCUUCCCCUUGUCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1470 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1470 miRNA Mature ID miR-1470

miRNA Sequence

 GCCCUCCGCCCGUGCACCCCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-2276 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2276 miRNA Mature ID miR-2276-5p

miRNA Sequence

 GCCCUCUGUCACCUUGCAGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-2682 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2682 miRNA Mature ID miR-2682-3p

miRNA Sequence

 CGCCUCUUCAGCGCUGUCUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-3194 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3194 miRNA Mature ID miR-3194-3p

miRNA Sequence

 AGCUCUGCUGCUCACUGGCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-4267 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

 UCCAGCUCGGUGGCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4469 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4667 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4667 miRNA Mature ID miR-4667-3p

miRNA Sequence

 UCCCUCCUUCUGUCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4699 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4699 miRNA Mature ID miR-4699-3p

miRNA Sequence

 AAUUUACUCUGCAAUCUUCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-5001 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5001 miRNA Mature ID miR-5001-3p

miRNA Sequence

 UUCUGCCUCUGUCCAGGUCCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-5586 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5586 miRNA Mature ID miR-5586-5p

miRNA Sequence

 UAUCCAGCUUGUUACUAUAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-642a directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-642a miRNA Mature ID miR-642a-5p

miRNA Sequence

 GUCCCUCUCCAAAUGUGUCUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-6781 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6781 miRNA Mature ID miR-6781-3p

miRNA Sequence

 UGCCUCUUUUCCACGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6892 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-877 directly targets SLC35B1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

 UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 DNA Methylation Dynamics in Urological Tumors.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.