Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0298 Transporter Info
Gene Name SLC35D1
Transporter Name UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter
Gene ID
23169
UniProt ID
Q9NTN3
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg12859923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.13E-02; Z-score: -1.11E-01

Methylation in Case

 7.20E-02 (Median) Methylation in Control 7.32E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg19283196)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 9.82E-05; Z-score: 4.44E-01

Methylation in Case

 3.21E-01 (Median) Methylation in Control 2.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg23130076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.20E-02; Z-score: 1.89E-01

Methylation in Case

 2.84E-02 (Median) Methylation in Control 2.71E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg00790847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 2.17E-06; Z-score: 1.17E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg27357229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.97E-03; Z-score: -8.33E-01

Methylation in Case

 6.40E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35D1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg19614911)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.83E-02; Z-score: 2.48E-01

Methylation in Case

 3.64E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in prostate cancer [ 2 ]

Location

 5'UTR (cg16772035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.41E+00 Statistic Test p-value: 1.97E-03; Z-score: 6.71E+00

Methylation in Case

 3.14E-01 (Median) Methylation in Control 7.13E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg06794441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.05E-03; Z-score: -2.41E+00

Methylation in Case

 7.88E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg21115004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.77E+00 Statistic Test p-value: 1.37E-02; Z-score: -1.54E+00

Methylation in Case

 5.55E-02 (Median) Methylation in Control 9.84E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 1.12E-08; Z-score: -1.00E+01

Methylation in Case

 5.02E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 Body (cg23015917)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.71E+00 Statistic Test p-value: 3.29E-04; Z-score: 3.36E+00

Methylation in Case

 5.08E-01 (Median) Methylation in Control 2.97E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 Body (cg19764326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.95E-02; Z-score: -1.07E+00

Methylation in Case

 5.83E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35D1 in bladder cancer [ 3 ]

Location

 Body (cg13986884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.04E-02; Z-score: -6.48E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 TSS1500 (cg25208677)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.43E-02; Z-score: 5.12E-01

Methylation in Case

 7.32E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 TSS200 (cg14626797)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.35E-03; Z-score: 1.28E+00

Methylation in Case

 1.47E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 Body (cg23015917)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.97E+00 Statistic Test p-value: 6.16E-30; Z-score: 3.83E+00

Methylation in Case

 5.69E-01 (Median) Methylation in Control 2.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.79E-04; Z-score: -3.32E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 Body (cg13986884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.50E-02; Z-score: 4.86E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 Body (cg17930550)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.92E-02; Z-score: 4.48E-01

Methylation in Case

 1.36E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC35D1 in breast cancer [ 4 ]

Location

 Body (cg19764326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.01E-02; Z-score: -5.83E-01

Methylation in Case

 6.09E-01 (Median) Methylation in Control 6.47E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg21115004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 8.61E-03; Z-score: -3.87E-01

Methylation in Case

 7.89E-02 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg14626797)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.45E-02; Z-score: -5.78E-01

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg14607894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.56E+00 Statistic Test p-value: 2.91E-21; Z-score: -2.95E+00

Methylation in Case

 4.44E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg19764326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.69E-02; Z-score: -4.97E-01

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.22E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.71E-02; Z-score: -1.66E-01

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35D1 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg23722790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.38E-06; Z-score: 1.14E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg21115004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 1.90E-03; Z-score: -1.72E+00

Methylation in Case

 1.19E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in colorectal cancer [ 7 ]

Location

 TSS200 (cg14626797)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.21E-04; Z-score: 9.75E-01

Methylation in Case

 2.68E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in colorectal cancer [ 7 ]

Location

 Body (cg19764326)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.21E-06; Z-score: -1.12E+00

Methylation in Case

 8.52E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in colorectal cancer [ 7 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.86E-03; Z-score: 1.11E+00

Methylation in Case

 8.86E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D1 in colorectal cancer [ 7 ]

Location

 Body (cg23015917)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.04E-02; Z-score: 4.07E-01

Methylation in Case

 6.37E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D1 in colorectal cancer [ 7 ]

Location

 3'UTR (cg23722790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.84E-04; Z-score: 1.25E+00

Methylation in Case

 8.40E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg14626797)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.35E-03; Z-score: 7.71E-01

Methylation in Case

 1.28E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in papillary thyroid cancer [ 8 ]

Location

 3'UTR (cg23722790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 3.61E-10; Z-score: 1.47E+00

Methylation in Case

 6.73E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D1 in panic disorder [ 9 ]

Location

 1stExon (cg14206730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.75E-01 Statistic Test p-value: 4.27E-02; Z-score: 3.62E-01

Methylation in Case

 -4.77E+00 (Median) Methylation in Control -4.89E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D1 in panic disorder [ 9 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.79E+00 Statistic Test p-value: 3.45E-08; Z-score: -9.74E-01

Methylation in Case

 5.84E-01 (Median) Methylation in Control 1.04E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D1 in panic disorder [ 9 ]

Location

 3'UTR (cg23722790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 2.19E-02; Z-score: -5.08E-01

Methylation in Case

 1.19E+00 (Median) Methylation in Control 1.39E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-130b directly targets SLC35D1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-141 directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-141 miRNA Mature ID miR-141-3p

miRNA Sequence

 UAACACUGUCUGGUAAAGAUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-19b directly targets SLC35D1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-200a directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-200a miRNA Mature ID miR-200a-3p

miRNA Sequence

 UAACACUGUCUGGUAACGAUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-3529 directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3529 miRNA Mature ID miR-3529-3p

miRNA Sequence

 AACAACAAAAUCACUAGUCUUCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-548ae directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ae miRNA Mature ID miR-548ae-3p

miRNA Sequence

 CAAAAACUGCAAUUACUUUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-548ah directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ah miRNA Mature ID miR-548ah-3p

miRNA Sequence

 CAAAAACUGCAGUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-548aj directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aj miRNA Mature ID miR-548aj-3p

miRNA Sequence

 UAAAAACUGCAAUUACUUUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-548am directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548am miRNA Mature ID miR-548am-3p

miRNA Sequence

 CAAAAACUGCAGUUACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-548aq directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aq miRNA Mature ID miR-548aq-3p

miRNA Sequence

 CAAAAACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-548j directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548j miRNA Mature ID miR-548j-3p

miRNA Sequence

 CAAAAACUGCAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-548x directly targets SLC35D1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548x miRNA Mature ID miR-548x-3p

miRNA Sequence

 UAAAAACUGCAAUUACUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-744 directly targets SLC35D1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-744 miRNA Mature ID miR-744-5p

miRNA Sequence

 UGCGGGGCUAGGGCUAACAGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
11 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
12 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.