Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0299 Transporter Info
Gene Name SLC35D2
Transporter Name UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose transporter
Gene ID
11046
UniProt ID
Q76EJ3
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in prostate cancer [ 1 ]

Location

 5'UTR (cg02305261)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.80E+00 Statistic Test p-value: 2.98E-02; Z-score: 3.07E+00

Methylation in Case

 5.53E-01 (Median) Methylation in Control 3.07E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in prostate cancer [ 1 ]

Location

 Body (cg05157486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 1.00E-02; Z-score: -2.28E+00

Methylation in Case

 2.15E-01 (Median) Methylation in Control 3.20E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in prostate cancer [ 1 ]

Location

 Body (cg16190510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 2.58E-02; Z-score: -3.02E+00

Methylation in Case

 4.20E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg13771161)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.84E+00 Statistic Test p-value: 6.60E-11; Z-score: -8.64E+00

Methylation in Case

 3.84E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in bladder cancer [ 2 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 6.06E-05; Z-score: -3.01E+00

Methylation in Case

 8.26E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in bladder cancer [ 2 ]

Location

 Body (cg14331316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 1.74E-04; Z-score: 4.42E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 4.87E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D2 in bladder cancer [ 2 ]

Location

 Body (cg13519061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.03E-03; Z-score: -3.80E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg13771161)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.94E-06; Z-score: -2.35E+00

Methylation in Case

 6.96E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.75E+00 Statistic Test p-value: 6.74E-04; Z-score: 1.11E+00

Methylation in Case

 2.21E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in HIV infection [ 4 ]

Location

 TSS1500 (cg13771161)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.93E-04; Z-score: -1.29E+00

Methylation in Case

 7.75E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in HIV infection [ 4 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 7.43E-09; Z-score: 2.58E+00

Methylation in Case

 5.49E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in HIV infection [ 4 ]

Location

 Body (cg15582789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.74E+00 Statistic Test p-value: 1.94E-08; Z-score: 2.93E+00

Methylation in Case

 3.66E-01 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D2 in HIV infection [ 4 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.37E-03; Z-score: -5.49E-01

Methylation in Case

 8.87E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in systemic lupus erythematosus [ 5 ]

Location

 TSS1500 (cg13771161)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.02E-02; Z-score: -2.64E-01

Methylation in Case

 7.25E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in systemic lupus erythematosus [ 5 ]

Location

 Body (cg14331316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.57E-02; Z-score: -2.36E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS200 (cg06898199)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.34E-02; Z-score: -3.37E-01

Methylation in Case

 5.90E-02 (Median) Methylation in Control 6.43E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg14122373)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 3.27E-06; Z-score: 1.40E+00

Methylation in Case

 5.61E-01 (Median) Methylation in Control 4.66E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg14634247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.19E-03; Z-score: -6.30E-01

Methylation in Case

 1.18E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg08455719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.56E-02; Z-score: 4.27E-01

Methylation in Case

 7.96E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D2 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg21938718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.83E-02; Z-score: 1.10E-01

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.50E-05; Z-score: -1.15E+00

Methylation in Case

 7.32E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg13519061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.69E-02; Z-score: 4.93E-01

Methylation in Case

 6.63E-01 (Median) Methylation in Control 5.93E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 Body (cg14331316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.57E-02; Z-score: 8.29E-01

Methylation in Case

 8.06E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in breast cancer [ 8 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.86E-14; Z-score: -2.09E+00

Methylation in Case

 8.29E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in breast cancer [ 8 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.82E+00 Statistic Test p-value: 2.70E-10; Z-score: 2.38E+00

Methylation in Case

 2.68E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in breast cancer [ 8 ]

Location

 Body (cg15582789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 1.03E-09; Z-score: 2.54E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35D2 in breast cancer [ 8 ]

Location

 Body (cg14331316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 2.00E-04; Z-score: -1.56E+00

Methylation in Case

 6.61E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35D2 in breast cancer [ 8 ]

Location

 Body (cg13519061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.06E-02; Z-score: -2.85E-01

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in colon adenocarcinoma [ 9 ]

Location

 Body (cg00145985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 2.90E-06; Z-score: -3.47E+00

Methylation in Case

 5.22E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in colon adenocarcinoma [ 9 ]

Location

 Body (cg12384004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 1.40E-04; Z-score: -2.31E+00

Methylation in Case

 4.31E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in colorectal cancer [ 10 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.89E-05; Z-score: -9.30E-01

Methylation in Case

 9.22E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in colorectal cancer [ 10 ]

Location

 Body (cg14331316)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.81E-02; Z-score: -5.68E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg15582789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 4.55E-07; Z-score: -1.25E+00

Methylation in Case

 1.15E-01 (Median) Methylation in Control 1.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 3.89E-06; Z-score: -1.10E+00

Methylation in Case

 1.97E-01 (Median) Methylation in Control 3.03E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.07E-06; Z-score: -6.38E-01

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in lung adenocarcinoma [ 12 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.99E-06; Z-score: -3.77E+00

Methylation in Case

 8.61E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in lung adenocarcinoma [ 12 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.66E+00 Statistic Test p-value: 6.06E-05; Z-score: 3.82E+00

Methylation in Case

 5.13E-01 (Median) Methylation in Control 3.10E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in lung adenocarcinoma [ 12 ]

Location

 Body (cg15582789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.98E+00 Statistic Test p-value: 2.53E-04; Z-score: 4.70E+00

Methylation in Case

 4.12E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in panic disorder [ 13 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.48E-01 Statistic Test p-value: 4.72E-03; Z-score: -3.59E-01

Methylation in Case

 -1.37E+00 (Median) Methylation in Control -1.16E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35D2 in papillary thyroid cancer [ 14 ]

Location

 Body (cg13519061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.09E-17; Z-score: 2.16E+00

Methylation in Case

 8.70E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35D2 in papillary thyroid cancer [ 14 ]

Location

 Body (cg21216944)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.09E-05; Z-score: -7.97E-01

Methylation in Case

 9.39E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35D2 in papillary thyroid cancer [ 14 ]

Location

 Body (cg00430036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 7.50E-03; Z-score: 8.23E-01

Methylation in Case

 1.60E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-193b directly targets SLC35D2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 miR-26b directly targets SLC35D2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 3

 miR-3123 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3123 miRNA Mature ID miR-3123

miRNA Sequence

 CAGAGAAUUGUUUAAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-34b directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-34b miRNA Mature ID miR-34b-3p

miRNA Sequence

 CAAUCACUAACUCCACUGCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-3614 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3614 miRNA Mature ID miR-3614-5p

miRNA Sequence

 CCACUUGGAUCUGAAGGCUGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-3929 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

 GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4478 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

 GAGGCUGAGCUGAGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-451b directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-451b miRNA Mature ID miR-451b

miRNA Sequence

 UAGCAAGAGAACCAUUACCAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-485 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-5690 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5690 miRNA Mature ID miR-5690

miRNA Sequence

 UCAGCUACUACCUCUAUUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-6500 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6500 miRNA Mature ID miR-6500-3p

miRNA Sequence

 ACACUUGUUGGGAUGACCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-6746 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6746 miRNA Mature ID miR-6746-5p

miRNA Sequence

 CCGGGAGAAGGAGGUGGCCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-6771 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6771 miRNA Mature ID miR-6771-5p

miRNA Sequence

 CUCGGGAGGGCAUGGGCCAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6828 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6828 miRNA Mature ID miR-6828-5p

miRNA Sequence

 AGGAAGCAAGAGAACCCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-6884 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

 AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-7977 directly targets SLC35D2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

 UUCCCAGCCAACGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-98 directly targets SLC35D2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
2 DNA Methylation Dynamics in Urological Tumors.
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15 MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9.
16 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
17 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.