Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0305 Transporter Info
Gene Name SLC35E4
Transporter Name Solute carrier family 35 member E4
Gene ID
339665
UniProt ID
Q6ICL7
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg06246950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.06E+00 Statistic Test p-value: 9.92E-04; Z-score: -2.74E+00

Methylation in Case

 2.21E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23072383)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.22E+00 Statistic Test p-value: 2.17E-03; Z-score: -3.12E+00

Methylation in Case

 5.81E-02 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 1stExon (cg26233253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.57E+00 Statistic Test p-value: 8.31E-06; Z-score: -4.23E+00

Methylation in Case

 2.83E-01 (Median) Methylation in Control 4.44E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 5.99E-05; Z-score: 7.16E+00

Methylation in Case

 5.53E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 9.14E-03; Z-score: -1.73E+00

Methylation in Case

 5.69E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35E4 in bladder cancer [ 1 ]

Location

 3'UTR (cg08622548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.51E-03; Z-score: -2.26E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in breast cancer [ 2 ]

Location

 TSS1500 (cg06246950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.54E-02; Z-score: -7.79E-01

Methylation in Case

 4.28E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in breast cancer [ 2 ]

Location

 1stExon (cg26233253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 6.84E-03; Z-score: 6.72E-01

Methylation in Case

 5.11E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in breast cancer [ 2 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.03E-02; Z-score: -8.96E-01

Methylation in Case

 5.09E-01 (Median) Methylation in Control 5.68E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in breast cancer [ 2 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.51E-02; Z-score: -3.31E-01

Methylation in Case

 5.57E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35E4 in breast cancer [ 2 ]

Location

 3'UTR (cg08622548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.12E-02; Z-score: -6.00E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg23072383)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.35E+00 Statistic Test p-value: 2.36E-11; Z-score: -3.05E+00

Methylation in Case

 5.64E-02 (Median) Methylation in Control 3.02E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg05610550)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.59E-02; Z-score: 8.01E-01

Methylation in Case

 2.94E-02 (Median) Methylation in Control 2.61E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg06246950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.09E-04; Z-score: -1.01E+00

Methylation in Case

 5.75E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg01217202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.90E-03; Z-score: 7.27E-01

Methylation in Case

 7.41E-02 (Median) Methylation in Control 6.82E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in colorectal cancer [ 4 ]

Location

 TSS200 (cg06330324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 4.37E-05; Z-score: -8.39E-01

Methylation in Case

 5.93E-02 (Median) Methylation in Control 9.00E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in colorectal cancer [ 4 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.01E-14; Z-score: -2.29E+00

Methylation in Case

 6.00E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg06246950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.33E-02; Z-score: -4.86E-01

Methylation in Case

 4.20E-01 (Median) Methylation in Control 4.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg13998988)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 3.50E-11; Z-score: -1.58E+00

Methylation in Case

 5.15E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg26233253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.43E-02; Z-score: 5.88E-01

Methylation in Case

 7.44E-01 (Median) Methylation in Control 7.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg23551873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 9.30E-16; Z-score: -9.43E+00

Methylation in Case

 6.05E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.57E-03; Z-score: -6.21E-01

Methylation in Case

 5.82E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35E4 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg08622548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.59E-06; Z-score: -9.54E-01

Methylation in Case

 8.31E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg06246950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 3.23E-02; Z-score: -1.11E+00

Methylation in Case

 4.27E-01 (Median) Methylation in Control 5.20E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in lung adenocarcinoma [ 6 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.88E-04; Z-score: -2.08E+00

Methylation in Case

 6.19E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in lung adenocarcinoma [ 6 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 8.49E-03; Z-score: -1.90E+00

Methylation in Case

 6.40E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg14005240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.32E-02; Z-score: -3.92E-01

Methylation in Case

 7.76E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 2.18E-02; Z-score: -9.36E-01

Methylation in Case

 4.88E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg01372572)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 4.44E-03; Z-score: 9.72E-01

Methylation in Case

 5.79E-01 (Median) Methylation in Control 4.89E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg01807748)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.85E-02; Z-score: 4.32E-01

Methylation in Case

 4.95E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg13728439)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.45E-02; Z-score: 7.62E-01

Methylation in Case

 7.20E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC35E4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.27E-03; Z-score: 9.83E-01

Methylation in Case

 6.77E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg23072383)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.15E+00 Statistic Test p-value: 5.59E-25; Z-score: -3.49E+00

Methylation in Case

 1.38E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg06330324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.07E-02; Z-score: -3.79E-01

Methylation in Case

 3.46E-02 (Median) Methylation in Control 3.90E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg05610550)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.93E-02; Z-score: -4.99E-01

Methylation in Case

 7.48E-02 (Median) Methylation in Control 8.24E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in papillary thyroid cancer [ 8 ]

Location

 1stExon (cg26233253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 8.94E-03; Z-score: -9.65E-01

Methylation in Case

 5.52E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg01217202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.91E-03; Z-score: -2.33E-01

Methylation in Case

 6.00E-02 (Median) Methylation in Control 6.28E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg23072383)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 4.58E-02; Z-score: -3.01E-01

Methylation in Case

 1.58E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg05610550)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.29E-02; Z-score: -5.06E-02

Methylation in Case

 7.38E-02 (Median) Methylation in Control 7.49E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC35E4 in systemic lupus erythematosus [ 9 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.31E-03; Z-score: -2.31E-01

Methylation in Case

 5.79E-01 (Median) Methylation in Control 5.87E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC35E4 in systemic lupus erythematosus [ 9 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.16E-02; Z-score: -2.66E-01

Methylation in Case

 6.32E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in panic disorder [ 10 ]

Location

 TSS200 (cg06330324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.77E-01 Statistic Test p-value: 1.06E-02; Z-score: 3.09E-01

Methylation in Case

 -5.40E+00 (Median) Methylation in Control -5.53E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in panic disorder [ 10 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.03E-02; Z-score: 3.87E-01

Methylation in Case

 2.34E+00 (Median) Methylation in Control 2.15E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in panic disorder [ 10 ]

Location

 Body (cg15648353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.45E-02; Z-score: 4.10E-01

Methylation in Case

 1.03E+00 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 1stExon (cg26233253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 4.79E-16; Z-score: -2.29E+00

Methylation in Case

 6.13E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 6.63E-03; Z-score: 3.99E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC35E4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg08622548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 5.46E-13; Z-score: -2.29E+00

Methylation in Case

 7.59E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in colon adenocarcinoma [ 12 ]

Location

 Body (cg14463790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 1.39E-08; Z-score: -4.49E+00

Methylation in Case

 4.44E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in colon adenocarcinoma [ 12 ]

Location

 Body (cg05070518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 3.72E-03; Z-score: 1.90E+00

Methylation in Case

 2.24E-01 (Median) Methylation in Control 1.56E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in depression [ 13 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.27E-02; Z-score: -6.12E-01

Methylation in Case

 7.34E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35E4 in HIV infection [ 14 ]

Location

 Body (cg08454563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 5.70E-05; Z-score: -2.27E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC35E4 in HIV infection [ 14 ]

Location

 3'UTR (cg08622548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.72E-02; Z-score: 4.60E-01

Methylation in Case

 8.92E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1224 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

 CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1245a directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1245a miRNA Mature ID miR-1245a

miRNA Sequence

 AAGUGAUCUAAAGGCCUACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1260a directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1260a miRNA Mature ID miR-1260a

miRNA Sequence

 AUCCCACCUCUGCCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1260b directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

 AUCCCACCACUGCCACCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-138-2 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-138-2 miRNA Mature ID miR-138-2-3p

miRNA Sequence

 GCUAUUUCACGACACCAGGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-4437 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4437 miRNA Mature ID miR-4437

miRNA Sequence

 UGGGCUCAGGGUACAAAGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4482 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4482 miRNA Mature ID miR-4482-3p

miRNA Sequence

 UUUCUAUUUCUCAGUGGGGCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4685 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4685 miRNA Mature ID miR-4685-5p

miRNA Sequence

 CCCAGGGCUUGGAGUGGGGCAAGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4735 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4735 miRNA Mature ID miR-4735-5p

miRNA Sequence

 CCUAAUUUGAACACCUUCGGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4775 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4775 miRNA Mature ID miR-4775

miRNA Sequence

 UUAAUUUUUUGUUUCGGUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-5088 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5088 miRNA Mature ID miR-5088-5p

miRNA Sequence

 CAGGGCUCAGGGAUUGGAUGGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-532 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-532 miRNA Mature ID miR-532-3p

miRNA Sequence

 CCUCCCACACCCAAGGCUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-590 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-590 miRNA Mature ID miR-590-3p

miRNA Sequence

 UAAUUUUAUGUAUAAGCUAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6513 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6513 miRNA Mature ID miR-6513-3p

miRNA Sequence

 UCAAGUGUCAUCUGUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-6749 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6749 miRNA Mature ID miR-6749-3p

miRNA Sequence

 CUCCUCCCCUGCCUGGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-6778 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-6819 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6819 miRNA Mature ID miR-6819-3p

miRNA Sequence

 AAGCCUCUGUCCCCACCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-6837 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6837 miRNA Mature ID miR-6837-5p

miRNA Sequence

 ACCAGGGCCAGCAGGGAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-6872 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6872 miRNA Mature ID miR-6872-3p

miRNA Sequence

 CCCAUGCCUCCUGCCGCGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-6877 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6877 miRNA Mature ID miR-6877-3p

miRNA Sequence

 CAGCCUCUGCCCUUGGCCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-7113 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7113 miRNA Mature ID miR-7113-5p

miRNA Sequence

 UCCAGGGAGACAGUGUGUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-7159 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7159 miRNA Mature ID miR-7159-3p

miRNA Sequence

 UUUCUAUGUUAGUUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-8079 directly targets SLC35E4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8079 miRNA Mature ID miR-8079

miRNA Sequence

 CAGUGAUCGUCUCUGCUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.