General Information of Drug Transporter (DT)
DT ID DTD0308 Transporter Info
Gene Name SLC35F3
Transporter Name Putative thiamine transporter SLC35F3
Gene ID
148641
UniProt ID
Q8IY50
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg10581876)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.18E+00 Statistic Test p-value: 2.75E-03; Z-score: -1.29E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 5.75E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg09984339)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.38E+00 Statistic Test p-value: 7.62E-05; Z-score: 1.69E+00

Methylation in Case

4.67E-01 (Median) Methylation in Control 3.39E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg03728296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.44E+00 Statistic Test p-value: 1.05E-04; Z-score: -1.44E+00

Methylation in Case

2.79E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg24970620)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.21E+00 Statistic Test p-value: 9.87E-04; Z-score: -1.40E+00

Methylation in Case

4.68E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg18749411)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 2.54E-05; Z-score: -3.65E+00

Methylation in Case

7.86E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 5.57E-05; Z-score: -2.45E+00

Methylation in Case

7.10E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg00087274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 5.51E-04; Z-score: 1.45E+00

Methylation in Case

7.19E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg14607894)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.23E+00 Statistic Test p-value: 7.79E-04; Z-score: -2.46E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg08605656)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 2.01E-03; Z-score: 7.37E-01

Methylation in Case

5.98E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in colon adenocarcinoma [ 1 ]

Location

Body (cg02456521)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 4.69E-03; Z-score: -2.20E+00

Methylation in Case

5.84E-01 (Median) Methylation in Control 6.49E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Prostate cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

5'UTR (cg13723431)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.39E+00 Statistic Test p-value: 6.09E-04; Z-score: 4.87E+00

Methylation in Case

8.00E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

5'UTR (cg02151779)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.68E+00 Statistic Test p-value: 1.03E-02; Z-score: 2.56E+00

Methylation in Case

6.07E-01 (Median) Methylation in Control 3.61E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

TSS1500 (cg26220298)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.33E+00 Statistic Test p-value: 1.45E-03; Z-score: 1.24E+01

Methylation in Case

8.74E-02 (Median) Methylation in Control 6.56E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

TSS1500 (cg01807770)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 9.27E-03; Z-score: 4.29E+00

Methylation in Case

9.19E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

1stExon (cg11065621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.41E+00 Statistic Test p-value: 3.02E-02; Z-score: -5.61E+00

Methylation in Case

5.17E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

Body (cg02715407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 3.53E-02; Z-score: 1.62E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

Body (cg04609875)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 3.84E-02; Z-score: 2.04E+00

Methylation in Case

9.06E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in prostate cancer [ 2 ]

Location

Body (cg25903588)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.87E-02; Z-score: 1.69E+00

Methylation in Case

9.54E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

         28 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

TSS1500 (cg10878114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.14E+00 Statistic Test p-value: 3.56E-06; Z-score: 5.95E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

TSS1500 (cg21396646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.36E+00 Statistic Test p-value: 6.04E-04; Z-score: 4.05E+00

Methylation in Case

8.70E-01 (Median) Methylation in Control 6.38E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 4.98E+00 Statistic Test p-value: 1.11E-03; Z-score: 3.23E+00

Methylation in Case

7.21E-02 (Median) Methylation in Control 1.45E-02 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.68E+00 Statistic Test p-value: 1.55E-05; Z-score: 1.45E+01

Methylation in Case

2.14E-01 (Median) Methylation in Control 8.00E-02 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg04310063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.73E+00 Statistic Test p-value: 7.65E-15; Z-score: -3.51E+01

Methylation in Case

2.94E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.60E+00 Statistic Test p-value: 8.02E-14; Z-score: -1.65E+01

Methylation in Case

2.36E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg17898069)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.31E+00 Statistic Test p-value: 6.34E-10; Z-score: -1.31E+01

Methylation in Case

2.08E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.50E+00 Statistic Test p-value: 2.77E-09; Z-score: -1.12E+01

Methylation in Case

5.14E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.77E+00 Statistic Test p-value: 1.64E-08; Z-score: -9.72E+00

Methylation in Case

1.70E-01 (Median) Methylation in Control 3.00E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg25736663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.05E+00 Statistic Test p-value: 2.07E-07; Z-score: -9.97E+00

Methylation in Case

2.04E-01 (Median) Methylation in Control 4.18E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.37E+00 Statistic Test p-value: 2.37E-07; Z-score: 2.77E+01

Methylation in Case

4.17E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.86E+00 Statistic Test p-value: 7.63E-07; Z-score: 5.94E+00

Methylation in Case

5.43E-01 (Median) Methylation in Control 2.92E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg13908310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 1.39E-06; Z-score: -5.14E+00

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg20267718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.17E+00 Statistic Test p-value: 5.07E-05; Z-score: -5.10E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.56E+00 Statistic Test p-value: 5.35E-05; Z-score: -5.25E+00

Methylation in Case

1.81E-01 (Median) Methylation in Control 2.82E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg23603573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.21E+00 Statistic Test p-value: 5.50E-05; Z-score: -1.02E+01

Methylation in Case

6.98E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg01420001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.53E+00 Statistic Test p-value: 1.62E-04; Z-score: -5.27E+00

Methylation in Case

4.47E-01 (Median) Methylation in Control 6.81E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.90E+00 Statistic Test p-value: 2.54E-04; Z-score: -6.35E+00

Methylation in Case

3.29E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.89E+00 Statistic Test p-value: 3.53E-04; Z-score: -5.32E+00

Methylation in Case

2.15E-01 (Median) Methylation in Control 4.06E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg08455719)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 4.74E-04; Z-score: -2.96E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 5.43E-04; Z-score: -4.83E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg17451688)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 1.47E-03; Z-score: -3.04E+00

Methylation in Case

8.01E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 2.93E-03; Z-score: -7.72E+00

Methylation in Case

6.58E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg23093692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.41E+00 Statistic Test p-value: 1.11E-02; Z-score: -2.15E+00

Methylation in Case

5.61E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.12E+00 Statistic Test p-value: 1.74E-02; Z-score: 1.02E+00

Methylation in Case

1.41E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 26

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 2.91E-02; Z-score: 1.68E+00

Methylation in Case

1.04E-01 (Median) Methylation in Control 9.40E-02 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 27

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 4.62E-02; Z-score: 1.19E+00

Methylation in Case

1.37E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 28

Methylation of SLC35F3 in bladder cancer [ 3 ]

Location

3'UTR (cg07169618)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 4.10E-03; Z-score: -2.74E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         34 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

TSS1500 (cg10878114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.34E+00 Statistic Test p-value: 1.00E-06; Z-score: 1.60E+00

Methylation in Case

3.87E-01 (Median) Methylation in Control 2.88E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

TSS1500 (cg21396646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 3.08E-06; Z-score: 1.62E+00

Methylation in Case

6.62E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.46E+00 Statistic Test p-value: 1.67E-05; Z-score: 5.54E-01

Methylation in Case

3.15E-02 (Median) Methylation in Control 2.16E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.00E+00 Statistic Test p-value: 7.46E-09; Z-score: 1.71E+00

Methylation in Case

1.01E-01 (Median) Methylation in Control 5.08E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg17898069)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.38E+00 Statistic Test p-value: 1.43E-14; Z-score: -3.19E+00

Methylation in Case

4.58E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.37E+00 Statistic Test p-value: 5.13E-14; Z-score: -2.46E+00

Methylation in Case

4.26E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.58E+00 Statistic Test p-value: 1.22E-09; Z-score: 1.98E+00

Methylation in Case

4.10E-01 (Median) Methylation in Control 2.60E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.52E+00 Statistic Test p-value: 3.18E-09; Z-score: 2.45E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 2.99E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg18190030)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.44E+00 Statistic Test p-value: 7.03E-09; Z-score: 1.96E+00

Methylation in Case

9.33E-02 (Median) Methylation in Control 6.50E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.21E+00 Statistic Test p-value: 7.71E-08; Z-score: 1.62E+00

Methylation in Case

5.18E-01 (Median) Methylation in Control 4.29E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg16648603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.65E-06; Z-score: -1.29E+00

Methylation in Case

8.62E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 1.77E-06; Z-score: -1.37E+00

Methylation in Case

7.61E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.20E+00 Statistic Test p-value: 5.10E-06; Z-score: 1.13E+00

Methylation in Case

1.42E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg21002575)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.32E-05; Z-score: -7.80E-01

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg00662647)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.64E+00 Statistic Test p-value: 1.36E-05; Z-score: 6.61E-01

Methylation in Case

3.12E-02 (Median) Methylation in Control 1.90E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg20267718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 1.76E-05; Z-score: -1.09E+00

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 3.87E-05; Z-score: 2.07E+00

Methylation in Case

3.11E-01 (Median) Methylation in Control 2.47E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg17451688)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 4.90E-05; Z-score: -9.62E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg23093692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 5.42E-05; Z-score: -1.45E+00

Methylation in Case

6.35E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 1.40E-04; Z-score: -7.83E-01

Methylation in Case

6.77E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 1.95E-04; Z-score: 6.77E-01

Methylation in Case

1.30E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg23603573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 2.13E-04; Z-score: -1.17E+00

Methylation in Case

7.28E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg26802210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 3.40E-04; Z-score: -5.99E-01

Methylation in Case

8.11E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 4.06E-04; Z-score: 5.39E-01

Methylation in Case

8.39E-02 (Median) Methylation in Control 7.43E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.12E+00 Statistic Test p-value: 7.08E-04; Z-score: 5.49E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 9.03E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 26

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg10228857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 2.37E-03; Z-score: -5.59E-01

Methylation in Case

5.89E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 27

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 3.10E-03; Z-score: 5.51E-01

Methylation in Case

1.75E-02 (Median) Methylation in Control 1.39E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 28

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 4.71E-03; Z-score: -7.31E-01

Methylation in Case

3.22E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 29

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 8.69E-03; Z-score: -2.40E-01

Methylation in Case

6.23E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 30

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg04919681)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.00E+00 Statistic Test p-value: 1.04E-02; Z-score: 6.46E-02

Methylation in Case

7.81E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 31

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 1.20E-02; Z-score: -5.19E-01

Methylation in Case

4.37E-01 (Median) Methylation in Control 4.80E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 32

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg24723561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 1.64E-02; Z-score: 4.30E-01

Methylation in Case

6.15E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 33

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg01420001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 2.95E-02; Z-score: -4.99E-01

Methylation in Case

6.26E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 34

Methylation of SLC35F3 in breast cancer [ 4 ]

Location

Body (cg04143909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 3.67E-02; Z-score: -6.55E-01

Methylation in Case

6.91E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 1.89E-02; Z-score: 3.27E-01

Methylation in Case

1.69E-02 (Median) Methylation in Control 1.60E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.53E+00 Statistic Test p-value: 4.07E-02; Z-score: 5.78E-01

Methylation in Case

2.47E-02 (Median) Methylation in Control 1.61E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 6.76E-05; Z-score: -1.98E+00

Methylation in Case

9.26E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg04919681)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.89E-04; Z-score: -1.80E+00

Methylation in Case

9.38E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.78E+00 Statistic Test p-value: 2.94E-04; Z-score: 1.21E+00

Methylation in Case

1.07E-01 (Median) Methylation in Control 6.01E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 4.49E-04; Z-score: 7.99E-01

Methylation in Case

8.76E-02 (Median) Methylation in Control 6.97E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 3.39E-03; Z-score: 3.55E-01

Methylation in Case

7.13E-02 (Median) Methylation in Control 6.33E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg18190030)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 4.94E-03; Z-score: 4.12E-01

Methylation in Case

4.74E-02 (Median) Methylation in Control 4.29E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 6.27E-03; Z-score: 4.23E-01

Methylation in Case

6.92E-02 (Median) Methylation in Control 6.41E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 1.30E-02; Z-score: 5.45E-01

Methylation in Case

2.08E-02 (Median) Methylation in Control 1.97E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg00662647)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 3.24E-02; Z-score: 1.00E+00

Methylation in Case

3.37E-02 (Median) Methylation in Control 3.11E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg01420001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 4.71E-02; Z-score: 7.95E-01

Methylation in Case

9.16E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         34 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 9.52E+00 Statistic Test p-value: 2.45E-14; Z-score: 2.11E+01

Methylation in Case

2.11E-01 (Median) Methylation in Control 2.21E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

TSS1500 (cg10878114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.28E+00 Statistic Test p-value: 1.47E-07; Z-score: 2.11E+00

Methylation in Case

6.97E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.51E+00 Statistic Test p-value: 1.38E-21; Z-score: 1.10E+01

Methylation in Case

6.07E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.34E+00 Statistic Test p-value: 2.55E-15; Z-score: -4.60E+00

Methylation in Case

6.22E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg00662647)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 6.63E+00 Statistic Test p-value: 4.09E-12; Z-score: 1.23E+01

Methylation in Case

3.82E-01 (Median) Methylation in Control 5.76E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.22E+00 Statistic Test p-value: 4.81E-12; Z-score: 7.66E+00

Methylation in Case

4.15E-01 (Median) Methylation in Control 1.87E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.13E+00 Statistic Test p-value: 1.64E-11; Z-score: 8.12E+00

Methylation in Case

5.64E-01 (Median) Methylation in Control 2.65E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.09E+00 Statistic Test p-value: 3.96E-11; Z-score: 7.60E+00

Methylation in Case

2.65E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg23093692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.33E+00 Statistic Test p-value: 5.26E-11; Z-score: -2.35E+00

Methylation in Case

6.16E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.21E+00 Statistic Test p-value: 6.40E-11; Z-score: 9.56E+00

Methylation in Case

3.58E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg04310063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 2.42E-10; Z-score: -6.64E+00

Methylation in Case

7.74E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 2.05E-09; Z-score: -4.93E+00

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 2.74E-08; Z-score: -4.51E+00

Methylation in Case

8.38E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg01420001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 1.17E-07; Z-score: -2.44E+00

Methylation in Case

7.76E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg08455719)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 1.30E-07; Z-score: -3.83E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.96E+00 Statistic Test p-value: 7.60E-07; Z-score: 2.83E+00

Methylation in Case

5.48E-02 (Median) Methylation in Control 2.80E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.34E+00 Statistic Test p-value: 2.03E-06; Z-score: 1.34E+00

Methylation in Case

7.60E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.40E+00 Statistic Test p-value: 6.32E-06; Z-score: -1.52E+00

Methylation in Case

4.64E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg17451688)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 6.68E-05; Z-score: -8.87E-01

Methylation in Case

9.21E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg20267718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 7.35E-05; Z-score: -1.38E+00

Methylation in Case

8.16E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg09674468)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 3.39E-04; Z-score: -9.56E-01

Methylation in Case

5.03E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg23603573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 5.63E-04; Z-score: -9.40E-01

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg15523980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 5.64E-04; Z-score: -5.58E-01

Methylation in Case

9.19E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg09119043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 1.31E-03; Z-score: -1.01E+00

Methylation in Case

6.60E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.43E-03; Z-score: -8.18E-01

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 26

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.29E+00 Statistic Test p-value: 2.54E-03; Z-score: 8.90E-01

Methylation in Case

4.16E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 27

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg04143909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 3.79E-03; Z-score: -7.59E-01

Methylation in Case

7.27E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 28

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 7.17E-03; Z-score: 7.75E-01

Methylation in Case

8.19E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 29

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg26802210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 7.51E-03; Z-score: -2.70E-01

Methylation in Case

8.99E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 30

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.21E+00 Statistic Test p-value: 1.80E-02; Z-score: -7.40E-01

Methylation in Case

5.04E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 31

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg21002575)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 3.55E-02; Z-score: -5.57E-01

Methylation in Case

8.67E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 32

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

Body (cg16648603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 4.12E-02; Z-score: 7.23E-02

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 33

Methylation of SLC35F3 in colorectal cancer [ 6 ]

Location

3'UTR (cg07169618)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 7.10E-04; Z-score: -1.22E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         31 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg18115428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.35E+00 Statistic Test p-value: 9.29E-08; Z-score: -2.14E+00

Methylation in Case

3.10E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 7.38E-04; Z-score: 2.52E-01

Methylation in Case

3.13E-02 (Median) Methylation in Control 2.76E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg17277001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.05E+00 Statistic Test p-value: 1.94E-21; Z-score: -4.52E+00

Methylation in Case

3.91E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg03736774)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.57E+00 Statistic Test p-value: 1.26E-17; Z-score: -6.05E+00

Methylation in Case

5.30E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg02135842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.38E+00 Statistic Test p-value: 1.14E-15; Z-score: -9.65E+00

Methylation in Case

5.97E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg17294136)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.31E+00 Statistic Test p-value: 3.71E-15; Z-score: -2.17E+00

Methylation in Case

5.09E-01 (Median) Methylation in Control 6.68E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg16926147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.34E+00 Statistic Test p-value: 8.61E-14; Z-score: -5.10E+00

Methylation in Case

5.01E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg14655994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.34E+00 Statistic Test p-value: 9.28E-14; Z-score: -3.66E+00

Methylation in Case

5.10E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg07986058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.03E+00 Statistic Test p-value: 5.78E-13; Z-score: -2.80E+00

Methylation in Case

2.07E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg05661459)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.29E+00 Statistic Test p-value: 1.68E-11; Z-score: -4.47E+00

Methylation in Case

6.57E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg20477005)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.57E+00 Statistic Test p-value: 3.72E-11; Z-score: -2.86E+00

Methylation in Case

3.00E-01 (Median) Methylation in Control 4.72E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg15164708)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.42E+00 Statistic Test p-value: 2.79E-10; Z-score: 4.51E+00

Methylation in Case

4.29E-01 (Median) Methylation in Control 3.02E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg15030789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.29E+00 Statistic Test p-value: 1.27E-09; Z-score: 1.83E+00

Methylation in Case

5.42E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg19115882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.41E+00 Statistic Test p-value: 1.43E-09; Z-score: -3.18E+00

Methylation in Case

4.42E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg21002575)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.38E+00 Statistic Test p-value: 5.29E-09; Z-score: -1.51E+00

Methylation in Case

6.13E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg00662647)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.78E+00 Statistic Test p-value: 1.00E-08; Z-score: 3.13E+00

Methylation in Case

1.46E-01 (Median) Methylation in Control 5.27E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg26802210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 1.86E-08; Z-score: -1.07E+00

Methylation in Case

7.91E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 8.09E-08; Z-score: -2.30E+00

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg23445321)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.18E+00 Statistic Test p-value: 2.03E-07; Z-score: -1.57E+00

Methylation in Case

6.22E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg24723561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.28E+00 Statistic Test p-value: 2.33E-06; Z-score: -1.68E+00

Methylation in Case

4.54E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg25736663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.21E+00 Statistic Test p-value: 2.84E-06; Z-score: -1.46E+00

Methylation in Case

4.04E-01 (Median) Methylation in Control 4.90E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.27E+00 Statistic Test p-value: 6.16E-05; Z-score: 1.04E+00

Methylation in Case

2.01E-01 (Median) Methylation in Control 1.59E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 2.07E-04; Z-score: 2.14E-01

Methylation in Case

1.41E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 1.21E-03; Z-score: 2.97E-01

Methylation in Case

3.51E-02 (Median) Methylation in Control 3.03E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.00E+00 Statistic Test p-value: 1.37E-03; Z-score: 8.51E-03

Methylation in Case

1.23E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 26

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 2.65E-03; Z-score: 1.32E-01

Methylation in Case

9.91E-02 (Median) Methylation in Control 9.73E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 27

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 4.37E-03; Z-score: 1.35E+00

Methylation in Case

4.04E-01 (Median) Methylation in Control 3.50E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 28

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg13908310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 4.53E-03; Z-score: -8.37E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 29

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.17E+00 Statistic Test p-value: 7.41E-03; Z-score: -7.05E-01

Methylation in Case

3.10E-01 (Median) Methylation in Control 3.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 30

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 8.31E-03; Z-score: -2.79E-01

Methylation in Case

1.14E-01 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 31

Methylation of SLC35F3 in hepatocellular carcinoma [ 7 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 4.09E-02; Z-score: -7.74E-01

Methylation in Case

4.49E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         25 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

TSS1500 (cg10878114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 5.03E-03; Z-score: 5.93E-01

Methylation in Case

3.95E-01 (Median) Methylation in Control 3.49E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

TSS1500 (cg18115428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 2.31E-02; Z-score: 2.84E-01

Methylation in Case

4.71E-01 (Median) Methylation in Control 4.44E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.61E+00 Statistic Test p-value: 2.39E-02; Z-score: 8.28E-01

Methylation in Case

2.03E-02 (Median) Methylation in Control 1.25E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.83E+00 Statistic Test p-value: 4.82E-05; Z-score: 1.94E+00

Methylation in Case

8.89E-02 (Median) Methylation in Control 4.86E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 9.01E-08; Z-score: 2.12E+00

Methylation in Case

8.09E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.55E+00 Statistic Test p-value: 3.53E-06; Z-score: 1.98E+00

Methylation in Case

2.13E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 8.58E-05; Z-score: -1.69E+00

Methylation in Case

7.79E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 1.12E-04; Z-score: -1.83E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.82E-04; Z-score: -1.15E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg04310063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 2.43E-04; Z-score: -9.82E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 4.12E-04; Z-score: 7.01E-01

Methylation in Case

5.46E-01 (Median) Methylation in Control 5.15E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg09674468)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 6.95E-04; Z-score: -6.28E-01

Methylation in Case

4.84E-01 (Median) Methylation in Control 5.28E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg23603573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 9.39E-04; Z-score: -1.28E+00

Methylation in Case

8.90E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.26E-03; Z-score: -1.09E+00

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 3.25E-03; Z-score: 7.50E-01

Methylation in Case

7.55E-01 (Median) Methylation in Control 7.13E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg18190030)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.18E+00 Statistic Test p-value: 3.96E-03; Z-score: 8.34E-01

Methylation in Case

7.25E-02 (Median) Methylation in Control 6.13E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.20E+00 Statistic Test p-value: 8.60E-03; Z-score: 9.53E-01

Methylation in Case

4.90E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 8.98E-03; Z-score: 8.29E-01

Methylation in Case

1.51E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 1.14E-02; Z-score: 7.94E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 9.58E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg17451688)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.45E-02; Z-score: -2.04E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.35E+00 Statistic Test p-value: 1.52E-02; Z-score: 6.07E-01

Methylation in Case

2.74E-02 (Median) Methylation in Control 2.03E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 1.84E-02; Z-score: 1.03E+00

Methylation in Case

1.11E-01 (Median) Methylation in Control 9.64E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg20267718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 3.95E-02; Z-score: -3.80E-01

Methylation in Case

8.98E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 4.07E-02; Z-score: 5.34E-01

Methylation in Case

9.19E-02 (Median) Methylation in Control 8.36E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in HIV infection [ 8 ]

Location

3'UTR (cg07169618)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 6.72E-03; Z-score: 3.31E-01

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg22685369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.41E+00 Statistic Test p-value: 1.56E-02; Z-score: 3.98E+00

Methylation in Case

9.62E-02 (Median) Methylation in Control 3.99E-02 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.68E+00 Statistic Test p-value: 1.55E-02; Z-score: 2.74E+00

Methylation in Case

1.51E-01 (Median) Methylation in Control 9.02E-02 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg09674468)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.22E+00 Statistic Test p-value: 1.87E-03; Z-score: 1.74E+00

Methylation in Case

4.44E-01 (Median) Methylation in Control 3.63E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.23E+00 Statistic Test p-value: 4.87E-03; Z-score: 3.11E+00

Methylation in Case

4.29E-01 (Median) Methylation in Control 1.92E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg19681897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 8.64E-03; Z-score: -2.58E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.22E+00 Statistic Test p-value: 1.02E-02; Z-score: 2.23E+00

Methylation in Case

5.82E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 2.00E-02; Z-score: 1.06E+00

Methylation in Case

5.59E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.31E+00 Statistic Test p-value: 3.03E-02; Z-score: 4.04E+00

Methylation in Case

1.65E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg04919681)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 3.27E-02; Z-score: 1.67E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 4.12E-02; Z-score: -3.12E+00

Methylation in Case

7.80E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.15E+00 Statistic Test p-value: 4.88E-02; Z-score: 1.14E+00

Methylation in Case

1.99E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in lung adenocarcinoma [ 9 ]

Location

Body (cg23093692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 4.93E-02; Z-score: -1.53E+00

Methylation in Case

8.22E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         28 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.60E+00 Statistic Test p-value: 8.19E-14; Z-score: -2.04E+00

Methylation in Case

2.20E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg15501281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.14E+00 Statistic Test p-value: 3.26E-10; Z-score: 4.32E-01

Methylation in Case

4.90E-02 (Median) Methylation in Control 4.29E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg21764029)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.16E-08; Z-score: -9.93E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg09984339)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.94E+00 Statistic Test p-value: 1.23E-06; Z-score: 1.78E+00

Methylation in Case

3.18E-01 (Median) Methylation in Control 8.08E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg03640993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 1.16E-05; Z-score: 1.58E+00

Methylation in Case

8.22E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg18639125)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.26E+00 Statistic Test p-value: 2.61E-04; Z-score: -1.69E+00

Methylation in Case

2.01E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg15108705)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 4.78E-03; Z-score: -6.54E-01

Methylation in Case

9.03E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg11694490)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.44E+00 Statistic Test p-value: 5.28E-33; Z-score: 6.50E+00

Methylation in Case

3.14E-01 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg15310492)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.82E+00 Statistic Test p-value: 1.74E-07; Z-score: 1.76E+00

Methylation in Case

4.28E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg24217844)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.14E+00 Statistic Test p-value: 2.15E-03; Z-score: 4.03E-01

Methylation in Case

2.07E-02 (Median) Methylation in Control 1.82E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg08221064)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 1.55E-02; Z-score: 6.38E-01

Methylation in Case

5.69E-02 (Median) Methylation in Control 5.11E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

1stExon (cg06123346)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.51E+00 Statistic Test p-value: 5.07E-09; Z-score: -2.04E+00

Methylation in Case

4.28E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

1stExon (cg11176737)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 5.47E-09; Z-score: 1.64E+00

Methylation in Case

4.82E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg08488915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 7.46E-13; Z-score: -1.93E+00

Methylation in Case

7.10E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg24304919)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.44E+00 Statistic Test p-value: 2.40E-11; Z-score: 2.18E+00

Methylation in Case

3.67E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg05138133)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.11E-08; Z-score: -1.02E+00

Methylation in Case

8.95E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg10355837)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 9.96E-08; Z-score: -2.37E-02

Methylation in Case

5.64E-02 (Median) Methylation in Control 5.68E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg26794221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.34E+00 Statistic Test p-value: 2.04E-07; Z-score: -1.70E+00

Methylation in Case

5.89E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg17030238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 4.31E-06; Z-score: 1.25E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg16300021)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 8.93E-06; Z-score: 9.33E-01

Methylation in Case

8.07E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg14002226)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.28E+00 Statistic Test p-value: 3.38E-05; Z-score: 1.45E+00

Methylation in Case

8.85E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg14678680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 4.11E-04; Z-score: 1.14E+00

Methylation in Case

8.64E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg07830086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 8.41E-04; Z-score: -4.70E-01

Methylation in Case

1.04E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 24

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg09337943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.73E-03; Z-score: -6.06E-01

Methylation in Case

7.55E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 25

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg23015917)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 1.21E-02; Z-score: -7.39E-01

Methylation in Case

5.25E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 26

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

3'UTR (cg10272922)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.08E-12; Z-score: -1.79E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 27

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

3'UTR (cg08241225)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.12E+00 Statistic Test p-value: 2.93E-06; Z-score: 1.05E+00

Methylation in Case

8.16E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 28

Methylation of SLC35F3 in pancretic ductal adenocarcinoma [ 10 ]

Location

3'UTR (cg16785291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 2.66E-03; Z-score: -8.10E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.15E+00 Statistic Test p-value: 4.68E-16; Z-score: -3.65E+00

Methylation in Case

7.36E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.30E+00 Statistic Test p-value: 1.81E-05; Z-score: 1.30E+00

Methylation in Case

8.32E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg00662647)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 3.17E-05; Z-score: -6.98E-01

Methylation in Case

8.38E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01420001)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 6.30E-05; Z-score: 9.17E-01

Methylation in Case

6.81E-01 (Median) Methylation in Control 5.70E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04143909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 5.67E-04; Z-score: -8.56E-01

Methylation in Case

7.71E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04310063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 6.88E-04; Z-score: 7.63E-01

Methylation in Case

4.98E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04919681)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 1.02E-03; Z-score: -7.05E-01

Methylation in Case

7.62E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 2.38E-03; Z-score: 8.35E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.49E-03; Z-score: 4.91E-01

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.34E+00 Statistic Test p-value: 4.39E-03; Z-score: -1.05E+00

Methylation in Case

2.41E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg08455719)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 6.76E-03; Z-score: -5.03E-01

Methylation in Case

8.77E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09119043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.21E+00 Statistic Test p-value: 9.23E-03; Z-score: 1.03E+00

Methylation in Case

5.77E-01 (Median) Methylation in Control 4.78E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09674468)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.18E-02; Z-score: 4.48E-01

Methylation in Case

8.17E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.20E-02; Z-score: -5.19E-01

Methylation in Case

8.64E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 1.41E-02; Z-score: 2.91E-02

Methylation in Case

2.00E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg10228857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.42E-02; Z-score: 4.98E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.67E+00 Statistic Test p-value: 1.48E-02; Z-score: 6.43E-01

Methylation in Case

2.26E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg10701282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.30E+00 Statistic Test p-value: 1.74E-02; Z-score: -1.01E+00

Methylation in Case

3.10E-01 (Median) Methylation in Control 4.01E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.22E-02; Z-score: 2.51E-01

Methylation in Case

7.69E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 3.52E-02; Z-score: -4.89E-01

Methylation in Case

6.50E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg13908310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 3.97E-02; Z-score: 5.29E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.46E+00 Statistic Test p-value: 4.17E-02; Z-score: -9.88E-01

Methylation in Case

3.04E-02 (Median) Methylation in Control 4.45E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 23

Methylation of SLC35F3 in atypical teratoid rhabdoid tumor [ 11 ]

Location

3'UTR (cg07169618)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.56E+00 Statistic Test p-value: 2.01E-13; Z-score: -2.68E+00

Methylation in Case

4.06E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Depression

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in depression [ 12 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 1.46E-02; Z-score: 5.16E-01

Methylation in Case

1.19E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in depression [ 12 ]

Location

Body (cg10204807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 1.72E-02; Z-score: 6.43E-01

Methylation in Case

7.23E-02 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in depression [ 12 ]

Location

Body (cg24723561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 4.41E-02; Z-score: 4.15E-01

Methylation in Case

5.73E-01 (Median) Methylation in Control 5.32E-01 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in depression [ 12 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 4.51E-02; Z-score: 2.59E-01

Methylation in Case

8.33E-02 (Median) Methylation in Control 8.13E-02 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in panic disorder [ 13 ]

Location

Body (cg21002575)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 1.50E-02; Z-score: 9.62E-02

Methylation in Case

3.15E+00 (Median) Methylation in Control 3.12E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in panic disorder [ 13 ]

Location

Body (cg15523980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 4.98E-02; Z-score: 3.97E-01

Methylation in Case

2.58E+00 (Median) Methylation in Control 2.45E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg06369407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.20E+00 Statistic Test p-value: 3.91E-09; Z-score: -1.47E+00

Methylation in Case

6.10E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg24312105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 2.59E-05; Z-score: -8.08E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 9.06E-04; Z-score: 1.04E+00

Methylation in Case

4.86E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg20784768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 9.32E-04; Z-score: 1.29E+00

Methylation in Case

3.99E-01 (Median) Methylation in Control 3.39E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg18190030)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.21E+00 Statistic Test p-value: 1.75E-03; Z-score: -1.02E+00

Methylation in Case

1.36E-01 (Median) Methylation in Control 1.65E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 6.64E-03; Z-score: 5.13E-01

Methylation in Case

8.34E-02 (Median) Methylation in Control 7.21E-02 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 7.01E-03; Z-score: 2.86E-01

Methylation in Case

8.10E-02 (Median) Methylation in Control 7.81E-02 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 7.54E-03; Z-score: -4.88E-01

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg08455719)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.00E-02; Z-score: 1.08E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg13058819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.28E+00 Statistic Test p-value: 1.80E-02; Z-score: 6.40E-01

Methylation in Case

2.68E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg24723561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 1.81E-02; Z-score: 1.20E-01

Methylation in Case

5.93E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg23603573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 3.02E-02; Z-score: -4.53E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC35F3 in papillary thyroid cancer [ 14 ]

Location

Body (cg10467711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 3.31E-02; Z-score: 2.06E-01

Methylation in Case

9.74E-02 (Median) Methylation in Control 9.33E-02 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg09811123)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 2.00E-04; Z-score: -2.20E-01

Methylation in Case

1.16E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg16546432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 6.34E-04; Z-score: -2.36E-01

Methylation in Case

1.30E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg13359765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 5.23E-03; Z-score: -2.17E-01

Methylation in Case

5.98E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg00161124)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.14E+00 Statistic Test p-value: 6.97E-03; Z-score: 2.96E-01

Methylation in Case

3.86E-01 (Median) Methylation in Control 3.40E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg09674468)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 1.43E-02; Z-score: -1.69E-01

Methylation in Case

4.24E-01 (Median) Methylation in Control 4.44E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC35F3 in systemic lupus erythematosus [ 15 ]

Location

Body (cg07185425)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 4.01E-02; Z-score: -1.15E-01

Methylation in Case

8.95E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate/significant hypermethylation of SLC35F3 in gastric cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 1.74E-22; Fold-change: 0.200593979; Z-score: 1.80491171

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value: 8.21E-05; Fold-change: 0.331936233; Z-score: 12.37976327
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Malignant astrocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Moderate hypermethylation of SLC35F3 in malignant astrocytoma than that in healthy individual

Studied Phenotype

Malignant astrocytoma [ICD-11:2A00.12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 1.06E-37; Fold-change: 0.258393598; Z-score: 1.82863615
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypermethylation of SLC35F3 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 6.31E-07; Fold-change: 0.379419699; Z-score: 1.51188277
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypermethylation of SLC35F3 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 2.07E-32; Fold-change: 0.554438774; Z-score: 3.080063931
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-124 directly targets SLC35F3 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

miR-192 directly targets SLC35F3 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 3

miR-215 directly targets SLC35F3 [ 17 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
17 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.