Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0318 Transporter Info
Gene Name SLC36A1
Transporter Name Proton-coupled amino acid transporter 1
Gene ID
206358
UniProt ID
Q7Z2H8
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg07510333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.19E-07; Z-score: -1.17E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg14104257)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 7.86E-07; Z-score: 1.28E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg19532958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 3.09E-06; Z-score: 1.44E+00

Methylation in Case

 8.66E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg08758185)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 7.84E-03; Z-score: 6.29E-01

Methylation in Case

 2.28E-01 (Median) Methylation in Control 1.77E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg01574364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.34E-15; Z-score: -2.53E+00

Methylation in Case

 6.73E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg07510333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.11E-04; Z-score: -4.52E+00

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg19532958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 7.64E-03; Z-score: -2.08E+00

Methylation in Case

 2.98E-02 (Median) Methylation in Control 3.99E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg06451717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 3.05E-08; Z-score: -1.44E+01

Methylation in Case

 4.32E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg02074891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.01E-02; Z-score: -2.05E+00

Methylation in Case

 8.58E-02 (Median) Methylation in Control 9.55E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 TSS200 (cg04550063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 5.55E-03; Z-score: -2.31E+00

Methylation in Case

 7.68E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC36A1 in bladder cancer [ 2 ]

Location

 Body (cg25232795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.57E+00 Statistic Test p-value: 1.58E-06; Z-score: 6.97E+00

Methylation in Case

 8.22E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 5'UTR (cg07510333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.93E-05; Z-score: -9.85E-01

Methylation in Case

 7.75E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 5'UTR (cg14104257)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.60E-02; Z-score: -5.70E-01

Methylation in Case

 5.02E-02 (Median) Methylation in Control 5.91E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 TSS200 (cg04550063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 3.95E-05; Z-score: 1.04E+00

Methylation in Case

 9.28E-02 (Median) Methylation in Control 8.09E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 TSS200 (cg24157131)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.98E-02; Z-score: -4.08E-01

Methylation in Case

 2.36E-02 (Median) Methylation in Control 2.82E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 Body (cg08758185)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.75E-10; Z-score: -2.15E+00

Methylation in Case

 8.14E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 Body (cg25232795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.55E-02; Z-score: 9.31E-01

Methylation in Case

 7.18E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC36A1 in breast cancer [ 3 ]

Location

 Body (cg25658464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.92E-02; Z-score: 6.98E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg19532958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.01E-02; Z-score: 5.78E-01

Methylation in Case

 1.21E-02 (Median) Methylation in Control 1.08E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg06451717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.21E-02; Z-score: -7.62E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg04550063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 1.22E-03; Z-score: 1.77E+00

Methylation in Case

 4.96E-02 (Median) Methylation in Control 3.38E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg18581762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.29E-02; Z-score: 8.96E-02

Methylation in Case

 1.39E-02 (Median) Methylation in Control 1.38E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in HIV infection [ 5 ]

Location

 5'UTR (cg07510333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.58E-03; Z-score: -1.19E+00

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in HIV infection [ 5 ]

Location

 5'UTR (cg14104257)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.84E-02; Z-score: -4.46E-01

Methylation in Case

 5.56E-02 (Median) Methylation in Control 6.01E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in HIV infection [ 5 ]

Location

 TSS200 (cg04550063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 1.16E-04; Z-score: 1.39E+00

Methylation in Case

 1.22E-01 (Median) Methylation in Control 9.39E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in HIV infection [ 5 ]

Location

 Body (cg25232795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 1.58E-13; Z-score: 3.75E+00

Methylation in Case

 8.01E-01 (Median) Methylation in Control 5.82E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in HIV infection [ 5 ]

Location

 3'UTR (cg01574364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 2.57E-12; Z-score: 2.31E+00

Methylation in Case

 7.92E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in lung adenocarcinoma [ 6 ]

Location

 5'UTR (cg07510333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.60E-03; Z-score: -1.88E+00

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 5'UTR (cg05373457)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 1.03E-07; Z-score: 1.22E+00

Methylation in Case

 4.36E-01 (Median) Methylation in Control 3.71E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg05884711)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.07E-07; Z-score: 1.75E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS200 (cg07724977)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.89E+00 Statistic Test p-value: 4.61E-03; Z-score: 9.42E-01

Methylation in Case

 2.03E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg13013644)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.47E-03; Z-score: 5.74E-01

Methylation in Case

 6.45E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg20122849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 5.97E-03; Z-score: 9.96E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC36A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg21619775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.22E-02; Z-score: -6.55E-01

Methylation in Case

 6.94E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in systemic lupus erythematosus [ 8 ]

Location

 5'UTR (cg19532958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.05E-02; Z-score: -2.22E-01

Methylation in Case

 4.73E-02 (Median) Methylation in Control 5.06E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg00423729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.04E-02; Z-score: -8.65E-02

Methylation in Case

 5.69E-02 (Median) Methylation in Control 5.86E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg02074891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.12E-02; Z-score: -1.71E-01

Methylation in Case

 1.60E-01 (Median) Methylation in Control 1.68E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in systemic lupus erythematosus [ 8 ]

Location

 TSS200 (cg17364576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.97E-03; Z-score: -3.25E-01

Methylation in Case

 5.76E-02 (Median) Methylation in Control 6.22E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in systemic lupus erythematosus [ 8 ]

Location

 3'UTR (cg01574364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.97E-02; Z-score: -2.54E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in colon adenocarcinoma [ 9 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.57E-03; Z-score: -1.08E+00

Methylation in Case

 5.79E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in colon adenocarcinoma [ 9 ]

Location

 Body (cg02830714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.25E-04; Z-score: -2.70E+00

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in colon adenocarcinoma [ 9 ]

Location

 Body (cg11109122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 1.88E-03; Z-score: -1.23E+00

Methylation in Case

 8.72E-02 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in colorectal cancer [ 10 ]

Location

 TSS1500 (cg06451717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.62E-07; Z-score: -2.17E+00

Methylation in Case

 8.00E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in colorectal cancer [ 10 ]

Location

 TSS1500 (cg00423729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.51E-03; Z-score: -9.35E-01

Methylation in Case

 8.31E-02 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in colorectal cancer [ 10 ]

Location

 3'UTR (cg01574364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.34E-04; Z-score: -1.22E+00

Methylation in Case

 8.13E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 TSS1500 (cg06451717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.35E-03; Z-score: -3.88E-01

Methylation in Case

 7.78E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 TSS200 (cg04550063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 7.10E-05; Z-score: -4.94E-01

Methylation in Case

 7.81E-02 (Median) Methylation in Control 8.67E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg08450807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 1.62E-18; Z-score: -5.14E+00

Methylation in Case

 4.70E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg25658464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.61E-06; Z-score: -8.11E-01

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg08758185)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.08E-03; Z-score: -4.30E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC36A1 in hepatocellular carcinoma [ 11 ]

Location

 3'UTR (cg01574364)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.30E-04; Z-score: -1.25E+00

Methylation in Case

 6.86E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in papillary thyroid cancer [ 12 ]

Location

 TSS1500 (cg00423729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.17E-03; Z-score: -7.90E-01

Methylation in Case

 5.27E-02 (Median) Methylation in Control 6.15E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in papillary thyroid cancer [ 12 ]

Location

 TSS1500 (cg02074891)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.44E-02; Z-score: -3.71E-01

Methylation in Case

 1.22E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in panic disorder [ 13 ]

Location

 TSS200 (cg08724474)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.75E-01 Statistic Test p-value: 8.51E-03; Z-score: 3.54E-01

Methylation in Case

 -4.60E+00 (Median) Methylation in Control -4.71E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC36A1 in prostate cancer [ 14 ]

Location

 Body (cg26890189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 5.18E+00 Statistic Test p-value: 9.79E-04; Z-score: 8.13E+00

Methylation in Case

 4.51E-01 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC36A1 in prostate cancer [ 14 ]

Location

 Body (cg19846387)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.48E-02; Z-score: 1.92E+00

Methylation in Case

 4.85E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          33 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1226 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

 UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1228 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1228 miRNA Mature ID miR-1228-5p

miRNA Sequence

 GUGGGCGGGGGCAGGUGUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1295b directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1295b miRNA Mature ID miR-1295b-3p

miRNA Sequence

 AAUAGGCCACGGAUCUGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-143 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-143 miRNA Mature ID miR-143-5p

miRNA Sequence

 GGUGCAGUGCUGCAUCUCUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-15a directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-3p

miRNA Sequence

 CAGGCCAUAUUGUGCUGCCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-18a directly targets SLC36A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-18a miRNA Mature ID miR-18a-5p

miRNA Sequence

 UAAGGUGCAUCUAGUGCAGAUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-203b directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-203b miRNA Mature ID miR-203b-3p

miRNA Sequence

 UUGAACUGUUAAGAACCACUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3147 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3147 miRNA Mature ID miR-3147

miRNA Sequence

 GGUUGGGCAGUGAGGAGGGUGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-329 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-362 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3671 directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3671 miRNA Mature ID miR-3671

miRNA Sequence

 AUCAAAUAAGGACUAGUCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-381 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-5p

miRNA Sequence

 AGCGAGGUUGCCCUUUGUAUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3941 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-3944 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3944 miRNA Mature ID miR-3944-5p

miRNA Sequence

 UGUGCAGCAGGCCAACCGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4259 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4259 miRNA Mature ID miR-4259

miRNA Sequence

 CAGUUGGGUCUAGGGGUCAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4530 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4530 miRNA Mature ID miR-4530

miRNA Sequence

 CCCAGCAGGACGGGAGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4649 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4649 miRNA Mature ID miR-4649-5p

miRNA Sequence

 UGGGCGAGGGGUGGGCUCUCAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4717 directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4717 miRNA Mature ID miR-4717-5p

miRNA Sequence

 UAGGCCACAGCCACCCAUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4719 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4719 miRNA Mature ID miR-4719

miRNA Sequence

 UCACAAAUCUAUAAUAUGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-4756 directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4756 miRNA Mature ID miR-4756-3p

miRNA Sequence

 CCAGAGAUGGUUGCCUUCCUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-500a directly targets SLC36A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-500a miRNA Mature ID miR-500a-5p

miRNA Sequence

 UAAUCCUUGCUACCUGGGUGAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-5704 directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5704 miRNA Mature ID miR-5704

miRNA Sequence

 UUAGGCCAUCAUCCCAUUAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-571 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-571 miRNA Mature ID miR-571

miRNA Sequence

 UGAGUUGGCCAUCUGAGUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-603 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-634 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-634 miRNA Mature ID miR-634

miRNA Sequence

 AACCAGCACCCCAACUUUGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-6507 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6507 miRNA Mature ID miR-6507-5p

miRNA Sequence

 GAAGAAUAGGAGGGACUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-6729 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6729 miRNA Mature ID miR-6729-5p

miRNA Sequence

 UGGGCGAGGGCGGCUGAGCGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-6767 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6767 miRNA Mature ID miR-6767-3p

miRNA Sequence

 CCACGUGCUUCUCUUUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-6825 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

 UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-6872 directly targets SLC36A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6872 miRNA Mature ID miR-6872-3p

miRNA Sequence

 CCCAUGCCUCCUGCCGCGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-767 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

 UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-8485 directly targets SLC36A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-922 directly targets SLC36A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-922 miRNA Mature ID miR-922

miRNA Sequence

 GCAGCAGAGAAUAGGACUACGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
16 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
17 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
18 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
19 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.