Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0323 Transporter Info | ||||
Gene Name | SLC37A2 | ||||
Transporter Name | Glucose-6-phosphate exchanger SLC37A2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1304 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-181b directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-181b | miRNA Mature ID | miR-181b-3p | ||
miRNA Sequence |
CUCACUGAACAAUGAAUGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-1910 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1910 | miRNA Mature ID | miR-1910-3p | ||
miRNA Sequence |
GAGGCAGAAGCAGGAUGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-1972 directly targets SLC37A2 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1972 | miRNA Mature ID | miR-1972 | ||
miRNA Sequence |
UCAGGCCAGGCACAGUGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-211 directly targets SLC37A2 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-211 | miRNA Mature ID | miR-211-3p | ||
miRNA Sequence |
GCAGGGACAGCAAAGGGGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-2467 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-2467 | miRNA Mature ID | miR-2467-3p | ||
miRNA Sequence |
AGCAGAGGCAGAGAGGCUCAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-3065 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3065 | miRNA Mature ID | miR-3065-3p | ||
miRNA Sequence |
UCAGCACCAGGAUAUUGUUGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-3156 directly targets SLC37A2 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3156 | miRNA Mature ID | miR-3156-5p | ||
miRNA Sequence |
AAAGAUCUGGAAGUGGGAGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-3197 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3197 | miRNA Mature ID | miR-3197 | ||
miRNA Sequence |
GGAGGCGCAGGCUCGGAAAGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-335 directly targets SLC37A2 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-383 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-4286 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4286 | miRNA Mature ID | miR-4286 | ||
miRNA Sequence |
ACCCCACUCCUGGUACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4291 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4291 | miRNA Mature ID | miR-4291 | ||
miRNA Sequence |
UUCAGCAGGAACAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4329 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4329 | miRNA Mature ID | miR-4329 | ||
miRNA Sequence |
CCUGAGACCCUAGUUCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-4420 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4420 | miRNA Mature ID | miR-4420 | ||
miRNA Sequence |
GUCACUGAUGUCUGUAGCUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-4514 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4514 | miRNA Mature ID | miR-4514 | ||
miRNA Sequence |
ACAGGCAGGAUUGGGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-4645 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4645 | miRNA Mature ID | miR-4645-5p | ||
miRNA Sequence |
ACCAGGCAAGAAAUAUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-4673 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4673 | miRNA Mature ID | miR-4673 | ||
miRNA Sequence |
UCCAGGCAGGAGCCGGACUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-4692 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4692 | miRNA Mature ID | miR-4692 | ||
miRNA Sequence |
UCAGGCAGUGUGGGUAUCAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-4695 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4695 | miRNA Mature ID | miR-4695-5p | ||
miRNA Sequence |
CAGGAGGCAGUGGGCGAGCAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-4786 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4786 | miRNA Mature ID | miR-4786-5p | ||
miRNA Sequence |
UGAGACCAGGACUGGAUGCACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-584 directly targets SLC37A2 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-584 | miRNA Mature ID | miR-584-3p | ||
miRNA Sequence |
UCAGUUCCAGGCCAACCAGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-6511a directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6511a | miRNA Mature ID | miR-6511a-5p | ||
miRNA Sequence |
CAGGCAGAAGUGGGGCUGACAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-6847 directly targets SLC37A2 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6847 | miRNA Mature ID | miR-6847-5p | ||
miRNA Sequence |
ACAGAGGACAGUGGAGUGUGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 25 |
miR-6849 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6849 | miRNA Mature ID | miR-6849-3p | ||
miRNA Sequence |
ACCAGCCUGUGUCCACCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-6871 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6871 | miRNA Mature ID | miR-6871-3p | ||
miRNA Sequence |
CAGCACCCUGUGGCUCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-6872 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6872 | miRNA Mature ID | miR-6872-3p | ||
miRNA Sequence |
CCCAUGCCUCCUGCCGCGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-769 directly targets SLC37A2 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-769 | miRNA Mature ID | miR-769-5p | ||
miRNA Sequence |
UGAGACCUCUGGGUUCUGAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-7845 directly targets SLC37A2 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7845 | miRNA Mature ID | miR-7845-5p | ||
miRNA Sequence |
AAGGGACAGGGAGGGUCGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC37A2 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.24E-12; Fold-change: -0.645068884; Z-score: -4.42432093 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples | |||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.