Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0327 Transporter Info
Gene Name SLC38A10
Transporter Name Putative sodium-coupled neutral amino acid transporter 10
Gene ID
124565
UniProt ID
Q9HBR0
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg00774088)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 1.23E-10; Z-score: -5.36E+00

Methylation in Case

 6.63E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg08034816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.63E-02; Z-score: -1.91E-01

Methylation in Case

 7.24E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A10 in hepatocellular carcinoma [ 1 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 7.09E-05; Z-score: 9.43E-01

Methylation in Case

 6.29E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg03971338)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.74E+00 Statistic Test p-value: 5.11E-04; Z-score: 1.10E+00

Methylation in Case

 5.86E-01 (Median) Methylation in Control 3.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg05353290)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.39E-03; Z-score: 8.33E-01

Methylation in Case

 8.32E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A10 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg06005559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 2.02E-03; Z-score: 1.04E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A10 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg08034816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.25E-03; Z-score: 2.11E-01

Methylation in Case

 1.76E-01 (Median) Methylation in Control 1.70E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A10 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.14E-10; Z-score: -1.57E+00

Methylation in Case

 8.57E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in bladder cancer [ 3 ]

Location

 Body (cg06005559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.24E-04; Z-score: -4.97E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in bladder cancer [ 3 ]

Location

 Body (cg05353290)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.04E-02; Z-score: -8.46E-01

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A10 in bladder cancer [ 3 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.21E-03; Z-score: -3.35E+00

Methylation in Case

 6.68E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in colorectal cancer [ 4 ]

Location

 Body (cg06005559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.27E-06; Z-score: -2.40E+00

Methylation in Case

 8.88E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in colorectal cancer [ 4 ]

Location

 Body (cg24948499)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.49E+00 Statistic Test p-value: 3.80E-05; Z-score: 1.60E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A10 in colorectal cancer [ 4 ]

Location

 Body (cg08034816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.16E-03; Z-score: -5.67E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A10 in colorectal cancer [ 4 ]

Location

 Body (cg03971338)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.91E-03; Z-score: 9.18E-01

Methylation in Case

 7.33E-01 (Median) Methylation in Control 5.70E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A10 in colorectal cancer [ 4 ]

Location

 Body (cg22462714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 3.07E-02; Z-score: 7.20E-01

Methylation in Case

 6.44E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in depression [ 5 ]

Location

 Body (cg22462714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.13E-02; Z-score: 1.84E-01

Methylation in Case

 8.17E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in HIV infection [ 6 ]

Location

 Body (cg22462714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 7.25E-03; Z-score: 4.68E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in HIV infection [ 6 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 8.80E-07; Z-score: -3.30E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in lung adenocarcinoma [ 7 ]

Location

 Body (cg22462714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.78E-02; Z-score: -1.45E+00

Methylation in Case

 8.84E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in lung adenocarcinoma [ 7 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.01E-04; Z-score: -3.51E+00

Methylation in Case

 7.11E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg19604369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.97E-02; Z-score: -8.77E-02

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in papillary thyroid cancer [ 9 ]

Location

 Body (cg06005559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.79E-03; Z-score: -6.11E-01

Methylation in Case

 9.28E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A10 in papillary thyroid cancer [ 9 ]

Location

 Body (cg03971338)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.63E-02; Z-score: -5.16E-01

Methylation in Case

 8.67E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A10 in papillary thyroid cancer [ 9 ]

Location

 Body (cg08034816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.70E-02; Z-score: -5.28E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A10 in panic disorder [ 10 ]

Location

 3'UTR (cg19030682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.60E-02; Z-score: 3.26E-01

Methylation in Case

 2.67E+00 (Median) Methylation in Control 2.43E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-26b directly targets SLC38A10 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.