Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0329 Transporter Info
Gene Name SLC38A2
Transporter Name Sodium-coupled neutral amino acid transporter 2
Gene ID
54407
UniProt ID
Q96QD8
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg09973502)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 1.96E-07; Z-score: -1.19E+00

Methylation in Case

 1.84E-01 (Median) Methylation in Control 2.70E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10891888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.81E-07; Z-score: -1.12E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13591723)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.78E-07; Z-score: -9.74E-01

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 8.94E-03; Z-score: -5.98E-01

Methylation in Case

 7.39E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg23334507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 9.44E-10; Z-score: 1.76E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

 5'UTR (cg13591723)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.65E-02; Z-score: 5.81E-01

Methylation in Case

 1.16E-02 (Median) Methylation in Control 1.03E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS1500 (cg07688749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 5.82E-07; Z-score: 1.25E+00

Methylation in Case

 2.88E-02 (Median) Methylation in Control 2.32E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 3.90E-05; Z-score: 2.12E+00

Methylation in Case

 4.12E-02 (Median) Methylation in Control 2.87E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 5'UTR (cg09973502)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.97E-07; Z-score: 1.19E+00

Methylation in Case

 8.81E-02 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 5'UTR (cg10891888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.35E-02; Z-score: 6.84E-01

Methylation in Case

 1.45E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 8.14E-05; Z-score: -8.25E-01

Methylation in Case

 4.29E-02 (Median) Methylation in Control 6.61E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 2.89E-03; Z-score: 5.63E-01

Methylation in Case

 1.18E-01 (Median) Methylation in Control 8.75E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg07688749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 8.96E-03; Z-score: 7.98E-01

Methylation in Case

 8.99E-02 (Median) Methylation in Control 7.86E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.04E-02; Z-score: -9.34E-01

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.46E-02; Z-score: 7.34E-01

Methylation in Case

 4.45E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 TSS200 (cg10002103)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.02E-02; Z-score: 8.73E-01

Methylation in Case

 5.20E-02 (Median) Methylation in Control 4.45E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 4.24E-03; Z-score: 7.51E-01

Methylation in Case

 7.81E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

 3'UTR (cg23334507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 2.38E-03; Z-score: 7.39E-01

Methylation in Case

 9.11E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg13580008)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.64E+00 Statistic Test p-value: 2.81E-13; Z-score: 2.35E+00

Methylation in Case

 5.15E-01 (Median) Methylation in Control 3.14E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg12464898)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 7.76E-12; Z-score: -3.36E+00

Methylation in Case

 6.24E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg27435138)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.25E-19; Z-score: -5.96E+00

Methylation in Case

 4.66E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg16848712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 1.99E-04; Z-score: 1.21E+00

Methylation in Case

 3.25E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.83E+00 Statistic Test p-value: 7.63E-04; Z-score: 1.14E+00

Methylation in Case

 2.35E-01 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 4.20E-03; Z-score: 1.17E+00

Methylation in Case

 3.69E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.89E-02; Z-score: -8.15E-01

Methylation in Case

 6.07E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.34E-02; Z-score: -2.17E-02

Methylation in Case

 4.61E-02 (Median) Methylation in Control 4.63E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg18666630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 1.32E-14; Z-score: -2.76E+00

Methylation in Case

 2.75E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg17319718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 1.29E-12; Z-score: -3.79E+00

Methylation in Case

 7.40E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 5'UTR (cg09973502)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.64E-02; Z-score: -2.73E-01

Methylation in Case

 6.31E-02 (Median) Methylation in Control 6.59E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg21563683)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 3.40E-08; Z-score: 3.33E+00

Methylation in Case

 3.21E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 9.81E-08; Z-score: 2.19E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 6.53E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.75E+00 Statistic Test p-value: 8.08E-07; Z-score: 1.31E+00

Methylation in Case

 4.14E-02 (Median) Methylation in Control 2.37E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg27491190)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.80E-06; Z-score: 1.98E+00

Methylation in Case

 4.87E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 6.53E-03; Z-score: 9.69E-01

Methylation in Case

 1.02E-01 (Median) Methylation in Control 7.95E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 7.89E-03; Z-score: 1.13E+00

Methylation in Case

 3.84E-02 (Median) Methylation in Control 2.84E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 TSS1500 (cg07688749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.76E-02; Z-score: -5.05E-01

Methylation in Case

 5.59E-02 (Median) Methylation in Control 6.10E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A2 in HIV infection [ 5 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.82E-04; Z-score: -1.81E+00

Methylation in Case

 5.61E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 5'UTR (cg10891888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.61E-02; Z-score: 6.71E-01

Methylation in Case

 8.82E-02 (Median) Methylation in Control 8.08E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 5'UTR (cg13591723)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.35E-02; Z-score: 3.26E-01

Methylation in Case

 3.65E-02 (Median) Methylation in Control 3.47E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 5'UTR (cg09973502)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.29E-02; Z-score: 2.20E-01

Methylation in Case

 4.48E-02 (Median) Methylation in Control 4.36E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 1.24E-05; Z-score: -1.12E+00

Methylation in Case

 9.46E-02 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 8.57E-03; Z-score: 4.47E-01

Methylation in Case

 9.11E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg16848712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.49E-02; Z-score: 7.69E-01

Methylation in Case

 6.03E-01 (Median) Methylation in Control 5.62E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

 5'UTR (cg10891888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.03E-02; Z-score: -3.00E-02

Methylation in Case

 1.33E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 6.23E-03; Z-score: 2.58E-01

Methylation in Case

 3.79E-02 (Median) Methylation in Control 3.47E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

 Body (cg20830447)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 8.42E-03; Z-score: -1.03E-02

Methylation in Case

 6.75E-02 (Median) Methylation in Control 6.77E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg27491190)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 1.13E-04; Z-score: -4.53E+00

Methylation in Case

 3.73E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 3.82E-04; Z-score: -4.08E+00

Methylation in Case

 4.89E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg20408693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 3.99E-04; Z-score: -2.49E+00

Methylation in Case

 4.67E-02 (Median) Methylation in Control 5.86E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg21563683)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.02E+00 Statistic Test p-value: 1.32E-03; Z-score: -3.25E+00

Methylation in Case

 2.31E-01 (Median) Methylation in Control 4.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.49E+00 Statistic Test p-value: 1.23E-02; Z-score: -2.27E+00

Methylation in Case

 1.02E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 TSS1500 (cg16848712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 3.90E-02; Z-score: -1.43E+00

Methylation in Case

 1.85E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.09E+00 Statistic Test p-value: 1.08E-04; Z-score: -4.72E+00

Methylation in Case

 1.25E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 TSS1500 (cg16848712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 5.46E-03; Z-score: -8.56E-01

Methylation in Case

 5.43E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 TSS1500 (cg27491190)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 9.85E-03; Z-score: -9.57E-01

Methylation in Case

 6.20E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.21E-02; Z-score: -7.25E-01

Methylation in Case

 5.95E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.74E-02; Z-score: -4.94E-01

Methylation in Case

 5.25E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 TSS200 (cg15333818)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.86E-02; Z-score: 1.09E-01

Methylation in Case

 5.49E-02 (Median) Methylation in Control 5.30E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in breast cancer [ 9 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.00E-05; Z-score: 1.09E+00

Methylation in Case

 4.90E-01 (Median) Methylation in Control 4.26E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Celiac disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in celiac disease [ 10 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 1.49E-02; Z-score: 8.58E-01

Methylation in Case

 1.53E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Celiac disease [ ICD-11: DA95]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in depression [ 11 ]

Location

 TSS1500 (cg07688749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.14E-02; Z-score: 3.54E-01

Methylation in Case

 5.39E-02 (Median) Methylation in Control 5.19E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

 TSS1500 (cg21563683)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 2.65E-03; Z-score: 1.67E+00

Methylation in Case

 5.31E-01 (Median) Methylation in Control 4.34E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

 TSS1500 (cg19620086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.20E-02; Z-score: 1.86E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

 TSS1500 (cg16848712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 1.87E-02; Z-score: 2.23E+00

Methylation in Case

 3.74E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

 TSS1500 (cg06864895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 2.20E-02; Z-score: 1.62E+00

Methylation in Case

 4.61E-01 (Median) Methylation in Control 3.28E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

 TSS1500 (cg26212328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 2.77E-02; Z-score: 2.36E+00

Methylation in Case

 2.73E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 TSS200 (cg18069290)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.34E-02; Z-score: 6.96E-01

Methylation in Case

 4.42E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg11634297)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.72E-08; Z-score: -1.41E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg05169846)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 9.75E-04; Z-score: -1.12E+00

Methylation in Case

 1.19E-01 (Median) Methylation in Control 2.02E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg01421830)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.02E-03; Z-score: 1.10E+00

Methylation in Case

 6.43E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg26529851)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 1.34E-02; Z-score: 9.22E-01

Methylation in Case

 6.51E-01 (Median) Methylation in Control 5.54E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

 3'UTR (ch.13.268523R)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 5.67E-03; Z-score: -4.54E-01

Methylation in Case

 3.55E-02 (Median) Methylation in Control 5.31E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

 1stExon (cg05962092)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 9.24E-07; Z-score: 1.93E+00

Methylation in Case

 7.40E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

 1stExon (cg00056676)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 2.39E-03; Z-score: 1.76E+00

Methylation in Case

 1.32E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

 Body (cg01266985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.83E-05; Z-score: 2.19E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A2 in panic disorder [ 15 ]

Location

 Body (cg09050775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 5.36E-01 Statistic Test p-value: 3.09E-03; Z-score: 5.92E-01

Methylation in Case

 -2.33E-01 (Median) Methylation in Control -4.35E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A2 in panic disorder [ 15 ]

Location

 3'UTR (cg23334507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 3.89E-02; Z-score: -4.17E-01

Methylation in Case

 3.09E-01 (Median) Methylation in Control 4.95E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Early gestation women

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC38A2 in early gestation women [ 17 ]

Location

 Enchancer (cg10354880)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

 Early gestation women

Experimental Material

 Patient tissue samples

Additional Notes

 SLC38A2 had increased methylation in pancreatic gestation.

Histone acetylation

  Activated amino acid response signaling pathways

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hyperacetylation of SLC38A2 in activated amino acid response signaling pathways (compare with unfolded protein response signaling pathways) [ 16 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of SLC38A2 Experiment Method RT-qPCR

Studied Phenotype

 Activated amino acid response signaling pathways

Experimental Material

 Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

 Hyperacetylation of histone H3 and recruitment of the general transcription factors at the HepG2 SLC38A2 promoter occurred in response to the activated amino acid but not the unfolded protein.

microRNA

  Unclear Phenotype

          73 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC38A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 let-7e directly targets SLC38A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-101 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

 UACAGUACUGUGAUAACUGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-124 directly targets SLC38A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 5

 miR-1245b directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1245b miRNA Mature ID miR-1245b-3p

miRNA Sequence

 UCAGAUGAUCUAAAGGCCUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1269a directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1269a miRNA Mature ID miR-1269a

miRNA Sequence

 CUGGACUGAGCCGUGCUACUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-1269b directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1269b miRNA Mature ID miR-1269b

miRNA Sequence

 CUGGACUGAGCCAUGCUACUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-1288 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1288 miRNA Mature ID miR-1288-3p

miRNA Sequence

 UGGACUGCCCUGAUCUGGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-1296 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1296 miRNA Mature ID miR-1296-3p

miRNA Sequence

 GAGUGGGGCUUCGACCCUAACC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-130a directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

 CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-130b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-132 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

 UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-142 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-5p

miRNA Sequence

 CAUAAAGUAGAAAGCACUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-148a directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-148a miRNA Mature ID miR-148a-3p

miRNA Sequence

 UCAGUGCACUACAGAACUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-148b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

 UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-152 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-152 miRNA Mature ID miR-152-3p

miRNA Sequence

 UCAGUGCAUGACAGAACUUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-16 directly targets SLC38A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 18

 miR-181a directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

 AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-181b directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181b miRNA Mature ID miR-181b-5p

miRNA Sequence

 AACAUUCAUUGCUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-181c directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181c miRNA Mature ID miR-181c-5p

miRNA Sequence

 AACAUUCAACCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-181d directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181d miRNA Mature ID miR-181d-5p

miRNA Sequence

 AACAUUCAUUGUUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-1825 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1825 miRNA Mature ID miR-1825

miRNA Sequence

 UCCAGUGCCCUCCUCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-18a directly targets SLC38A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-18a miRNA Mature ID miR-18a-3p

miRNA Sequence

 ACUGCCCUAAGUGCUCCUUCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-193b directly targets SLC38A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-194 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-194 miRNA Mature ID miR-194-3p

miRNA Sequence

 CCAGUGGGGCUGCUGUUAUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 26

 miR-199a directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-199a miRNA Mature ID miR-199a-5p

miRNA Sequence

 CCCAGUGUUCAGACUACCUGUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-199b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-199b miRNA Mature ID miR-199b-5p

miRNA Sequence

 CCCAGUGUUUAGACUAUCUGUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-19a directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

 UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-19b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-212 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-212 miRNA Mature ID miR-212-3p

miRNA Sequence

 UAACAGUCUCCAGUCACGGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-2355 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2355 miRNA Mature ID miR-2355-3p

miRNA Sequence

 AUUGUCCUUGCUGUUUGGAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 32

 miR-26a directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

 UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-26b directly targets SLC38A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-301a directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

 CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 35

 miR-301b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

 CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-30a directly targets SLC38A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

 UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 37

 miR-3145 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3145 miRNA Mature ID miR-3145-3p

miRNA Sequence

 AGAUAUUUUGAGUGUUUGGAAUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-3161 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3161 miRNA Mature ID miR-3161

miRNA Sequence

 CUGAUAAGAACAGAGGCCCAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-320b directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-320b miRNA Mature ID miR-320b

miRNA Sequence

 AAAAGCUGGGUUGAGAGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-320c directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-320c miRNA Mature ID miR-320c

miRNA Sequence

 AAAAGCUGGGUUGAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-320d directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-320d miRNA Mature ID miR-320d

miRNA Sequence

 AAAAGCUGGGUUGAGAGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-335 directly targets SLC38A2 [ 25 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-340 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 44

 miR-3666 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

 CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-3912 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3912 miRNA Mature ID miR-3912-5p

miRNA Sequence

 AUGUCCAUAUUAUGGGUUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-4295 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

 CAGUGCAAUGUUUUCCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 47

 miR-4429 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4429 miRNA Mature ID miR-4429

miRNA Sequence

 AAAAGCUGGGCUGAGAGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 48

 miR-4450 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4450 miRNA Mature ID miR-4450

miRNA Sequence

 UGGGGAUUUGGAGAAGUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-4474 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4474 miRNA Mature ID miR-4474-3p

miRNA Sequence

 UUGUGGCUGGUCAUGAGGCUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 50

 miR-4515 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4515 miRNA Mature ID miR-4515

miRNA Sequence

 AGGACUGGACUCCCGGCAGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-454 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

 UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 52

 miR-455 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

 GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 53

 miR-4642 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4642 miRNA Mature ID miR-4642

miRNA Sequence

 AUGGCAUCGUCCCCUGGUGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-4646 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4646 miRNA Mature ID miR-4646-3p

miRNA Sequence

 AUUGUCCCUCUCCCUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 55

 miR-4682 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4682 miRNA Mature ID miR-4682

miRNA Sequence

 UCUGAGUUCCUGGAGCCUGGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-4699 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4699 miRNA Mature ID miR-4699-3p

miRNA Sequence

 AAUUUACUCUGCAAUCUUCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 57

 miR-4704 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4704 miRNA Mature ID miR-4704-5p

miRNA Sequence

 GACACUAGGCAUGUGAGUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 58

 miR-4711 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4711 miRNA Mature ID miR-4711-5p

miRNA Sequence

 UGCAUCAGGCCAGAAGACAUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-4731 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-3p

miRNA Sequence

 CACACAAGUGGCCCCCAACACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-4740 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4740 miRNA Mature ID miR-4740-5p

miRNA Sequence

 AGGACUGAUCCUCUCGGGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-4757 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4757 miRNA Mature ID miR-4757-5p

miRNA Sequence

 AGGCCUCUGUGACGUCACGGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-4789 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

 GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 63

 miR-4801 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4801 miRNA Mature ID miR-4801

miRNA Sequence

 UACACAAGAAAACCAAGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 64

 miR-491 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-491 miRNA Mature ID miR-491-5p

miRNA Sequence

 AGUGGGGAACCCUUCCAUGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 65

 miR-548at directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548at miRNA Mature ID miR-548at-5p

miRNA Sequence

 AAAAGUUAUUGCGGUUUUGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 66

 miR-5590 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5590 miRNA Mature ID miR-5590-3p

miRNA Sequence

 AAUAAAGUUCAUGUAUGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

 miR-599 directly targets SLC38A2 [ 24 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-599 miRNA Mature ID miR-599

miRNA Sequence

 GUUGUGUCAGUUUAUCAAAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 68

 miR-6744 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6744 miRNA Mature ID miR-6744-3p

miRNA Sequence

 GGGCCUCUCUUGUCAUCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 69

 miR-6857 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6857 miRNA Mature ID miR-6857-3p

miRNA Sequence

 UGACUGAGCUUCUCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 70

 miR-6857 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6857 miRNA Mature ID miR-6857-5p

miRNA Sequence

 UUGGGGAUUGGGUCAGGCCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-6878 directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6878 miRNA Mature ID miR-6878-3p

miRNA Sequence

 CUGGCCUCUUCUUUCUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 72

 miR-8081 directly targets SLC38A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8081 miRNA Mature ID miR-8081

miRNA Sequence

 CUUGAGUCGUGCCUUUCUGAAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 73

 miR-9-3p directly targets SLC38A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-9-3p miRNA Mature ID miR-9-3p

miRNA Sequence

 AUAAAGCUAGAUAACCGAAAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 DNA Methylation Dynamics in Urological Tumors.
9 Genome-wide Scan for Methylation Profiles in Breast Cancer
10 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Despite increased ATF4 binding at the C/EBP-ATF composite site following activation of the unfolded protein response, system A transporter 2 (SNAT2) transcription activity is repressed in HepG2 cells. J Biol Chem. 2008 Oct 10;283(41):27736-47.
17 Early gestation as the critical time-window for changes in the prenatal environment to affect the adult human blood methylome. Int J Epidemiol. 2015 Aug;44(4):1211-23.
18 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
19 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
20 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
21 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
22 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
23 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
24 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
25 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.