Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0332 Transporter Info
Gene Name SLC38A5
Transporter Name Sodium-coupled neutral amino acid transporter 5
Gene ID
92745
UniProt ID
Q8WUX1
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg02151779)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.20E-08; Z-score: -1.86E+00

Methylation in Case

 5.11E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg14522327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 9.24E-07; Z-score: 1.46E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg17590101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 2.10E-06; Z-score: 1.44E+00

Methylation in Case

 6.44E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.98E-06; Z-score: 1.19E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg20495737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.22E-06; Z-score: 1.16E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg24152857)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 8.01E-06; Z-score: 1.25E+00

Methylation in Case

 7.99E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg04700811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 3.19E-14; Z-score: -2.13E+00

Methylation in Case

 4.24E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A5 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.20E-09; Z-score: -1.96E+00

Methylation in Case

 7.36E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 3.86E-12; Z-score: -1.75E+01

Methylation in Case

 3.25E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg18492059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.16E+00 Statistic Test p-value: 8.37E-09; Z-score: -8.60E+00

Methylation in Case

 3.04E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg26735834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 4.02E-06; Z-score: -4.28E+00

Methylation in Case

 5.17E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg03021892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 5.53E-06; Z-score: -4.15E+00

Methylation in Case

 6.01E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 TSS200 (cg16536563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 5.35E-06; Z-score: -9.12E+00

Methylation in Case

 6.14E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 TSS200 (cg21197919)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 6.58E-06; Z-score: -8.08E+00

Methylation in Case

 6.56E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 Body (cg24455325)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.84E+00 Statistic Test p-value: 5.72E-07; Z-score: -2.84E+01

Methylation in Case

 2.82E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A5 in bladder cancer [ 2 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.35E-03; Z-score: -2.25E+00

Methylation in Case

 4.84E-01 (Median) Methylation in Control 6.07E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.22E-05; Z-score: -9.86E-01

Methylation in Case

 3.99E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 5'UTR (cg14522327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.13E-03; Z-score: 6.41E-01

Methylation in Case

 4.14E-01 (Median) Methylation in Control 3.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 5'UTR (cg17590101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.03E-02; Z-score: -7.40E-01

Methylation in Case

 6.91E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 5'UTR (cg20495737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 4.69E-02; Z-score: -7.84E-01

Methylation in Case

 5.47E-01 (Median) Methylation in Control 6.19E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 TSS1500 (cg26735834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.15E-05; Z-score: -1.02E+00

Methylation in Case

 5.98E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 TSS1500 (cg18492059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.51E-04; Z-score: -7.43E-01

Methylation in Case

 5.11E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in breast cancer [ 3 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.25E-02; Z-score: -9.14E-01

Methylation in Case

 5.59E-01 (Median) Methylation in Control 5.93E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 2.79E-07; Z-score: -1.47E+00

Methylation in Case

 4.33E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg14522327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.53E+00 Statistic Test p-value: 1.28E-02; Z-score: 4.42E-01

Methylation in Case

 1.53E-01 (Median) Methylation in Control 9.99E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg20495737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 2.65E-02; Z-score: 9.14E-01

Methylation in Case

 4.89E-01 (Median) Methylation in Control 3.99E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg03021892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 5.04E-09; Z-score: -1.67E+00

Methylation in Case

 6.67E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg18492059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.29E-05; Z-score: -8.83E-01

Methylation in Case

 7.60E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg26735834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.93E-03; Z-score: -2.38E-01

Methylation in Case

 8.67E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 TSS200 (cg21197919)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.49E-07; Z-score: -1.32E+00

Methylation in Case

 7.21E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 TSS200 (cg16536563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 5.90E-05; Z-score: -8.77E-01

Methylation in Case

 7.29E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg24455325)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.67E-08; Z-score: -1.90E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A5 in hepatocellular carcinoma [ 4 ]

Location

 3'UTR (cg04700811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.62E-07; Z-score: -1.32E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg20495737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.89E+00 Statistic Test p-value: 5.21E-04; Z-score: -1.92E+00

Methylation in Case

 1.25E-01 (Median) Methylation in Control 4.87E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg17590101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.17E+00 Statistic Test p-value: 6.18E-04; Z-score: -1.87E+00

Methylation in Case

 1.46E-01 (Median) Methylation in Control 6.09E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg14522327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.82E+00 Statistic Test p-value: 1.72E-03; Z-score: -1.58E+00

Methylation in Case

 6.13E-02 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg24152857)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -6.08E+00 Statistic Test p-value: 2.28E-03; Z-score: -1.63E+00

Methylation in Case

 5.20E-02 (Median) Methylation in Control 3.16E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg02151779)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.87E+00 Statistic Test p-value: 3.40E-03; Z-score: -1.65E+00

Methylation in Case

 4.26E-02 (Median) Methylation in Control 2.07E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.39E-02; Z-score: 3.19E-01

Methylation in Case

 4.63E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 TSS1500 (cg03021892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.22E-04; Z-score: 7.14E-01

Methylation in Case

 9.07E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 TSS1500 (cg18492059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.85E-03; Z-score: 1.01E+00

Methylation in Case

 8.68E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 TSS1500 (cg26735834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 8.96E-03; Z-score: 6.95E-01

Methylation in Case

 9.00E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 TSS200 (cg16536563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 6.58E-06; Z-score: 9.46E-01

Methylation in Case

 8.74E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 TSS200 (cg21197919)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.07E-04; Z-score: 7.88E-01

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.68E-04; Z-score: 1.12E+00

Methylation in Case

 9.12E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC38A5 in HIV infection [ 5 ]

Location

 3'UTR (cg04700811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.50E-03; Z-score: 1.05E+00

Methylation in Case

 9.38E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 5'UTR (cg19407886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.42E-04; Z-score: -3.23E-01

Methylation in Case

 5.00E-01 (Median) Methylation in Control 5.20E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 5'UTR (cg14522327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.07E-02; Z-score: 1.16E-01

Methylation in Case

 4.58E-01 (Median) Methylation in Control 4.40E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 5'UTR (cg24152857)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.50E-02; Z-score: 8.83E-02

Methylation in Case

 3.68E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 TSS1500 (cg03021892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.45E-04; Z-score: -3.94E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 TSS200 (cg16536563)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.62E-03; Z-score: -3.19E-01

Methylation in Case

 7.80E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 Body (cg24455325)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.79E-02; Z-score: -2.00E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.99E-03; Z-score: -3.06E-01

Methylation in Case

 8.13E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A5 in systemic lupus erythematosus [ 6 ]

Location

 3'UTR (cg04700811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 5.24E-03; Z-score: -1.48E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in colorectal cancer [ 7 ]

Location

 TSS1500 (cg03021892)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.92E-05; Z-score: -1.57E+00

Methylation in Case

 7.97E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in colorectal cancer [ 7 ]

Location

 TSS1500 (cg18492059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 8.56E-04; Z-score: -5.59E-01

Methylation in Case

 8.76E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in colorectal cancer [ 7 ]

Location

 TSS200 (cg21197919)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.77E-02; Z-score: -2.71E-01

Methylation in Case

 7.43E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in colorectal cancer [ 7 ]

Location

 Body (cg24455325)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 7.46E-03; Z-score: -6.43E-01

Methylation in Case

 8.40E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in colorectal cancer [ 7 ]

Location

 3'UTR (cg23948362)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.40E-02; Z-score: 1.60E-02

Methylation in Case

 8.74E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg14014225)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 1.27E-07; Z-score: 1.86E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg24682551)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 5.49E-08; Z-score: -1.08E+00

Methylation in Case

 2.89E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg24944109)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 9.21E-06; Z-score: 7.27E-01

Methylation in Case

 2.91E-01 (Median) Methylation in Control 2.47E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg01992487)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.10E-03; Z-score: 1.14E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg10091752)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.88E-03; Z-score: 7.10E-01

Methylation in Case

 3.81E-01 (Median) Methylation in Control 3.41E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg12835313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.42E-03; Z-score: -6.74E-01

Methylation in Case

 7.26E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg21732977)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.30E-02; Z-score: -7.33E-01

Methylation in Case

 4.45E-02 (Median) Methylation in Control 5.29E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Liver cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate/moderate hypomethylation of SLC38A5 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

 Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.005929079; Fold-change: -0.267144341; Z-score: -0.850938106

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 9.96E-14; Fold-change: -0.277234234; Z-score: -4.674285843
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

  Cerebellar liponeurocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC38A5 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

 Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.000199202; Fold-change: -0.347882468; Z-score: -1.963120564
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC38A5 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 9.00E-26; Fold-change: -0.449897408; Z-score: -3.516170859
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          31 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC38A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-124 directly targets SLC38A5 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 3

 miR-1281 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

 UCGCCUCCUCCUCUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-155 directly targets SLC38A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

 UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 5

 miR-16 directly targets SLC38A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 6

 miR-193b directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

 CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-2116 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2116 miRNA Mature ID miR-2116-3p

miRNA Sequence

 CCUCCCAUGCCAAGAACUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-30a directly targets SLC38A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

 UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 9

 miR-3170 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3170 miRNA Mature ID miR-3170

miRNA Sequence

 CUGGGGUUCUGAGACAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-3176 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3176 miRNA Mature ID miR-3176

miRNA Sequence

 ACUGGCCUGGGACUACCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-3661 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3661 miRNA Mature ID miR-3661

miRNA Sequence

 UGACCUGGGACUCGGACAGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-3922 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3922 miRNA Mature ID miR-3922-3p

miRNA Sequence

 UCUGGCCUUGACUUGACUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-4691 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4691 miRNA Mature ID miR-4691-5p

miRNA Sequence

 GUCCUCCAGGCCAUGAGCUGCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4733 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4733 miRNA Mature ID miR-4733-3p

miRNA Sequence

 CCACCAGGUCUAGCAUUGGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4757 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4757 miRNA Mature ID miR-4757-5p

miRNA Sequence

 AGGCCUCUGUGACGUCACGGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-4778 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4778 miRNA Mature ID miR-4778-3p

miRNA Sequence

 UCUUCUUCCUUUGCAGAGUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-492 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-492 miRNA Mature ID miR-492

miRNA Sequence

 AGGACCUGCGGGACAAGAUUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-5193 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5193 miRNA Mature ID miR-5193

miRNA Sequence

 UCCUCCUCUACCUCAUCCCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-631 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-631 miRNA Mature ID miR-631

miRNA Sequence

 AGACCUGGCCCAGACCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-660 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-660 miRNA Mature ID miR-660-3p

miRNA Sequence

 ACCUCCUGUGUGCAUGGAUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-6744 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6744 miRNA Mature ID miR-6744-3p

miRNA Sequence

 GGGCCUCUCUUGUCAUCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-6749 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6749 miRNA Mature ID miR-6749-3p

miRNA Sequence

 CUCCUCCCCUGCCUGGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-6791 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

 UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-6792 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6792 miRNA Mature ID miR-6792-3p

miRNA Sequence

 CUCCUCCACAGCCCCUGCUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-6829 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

 UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 26

 miR-6855 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6855 miRNA Mature ID miR-6855-5p

miRNA Sequence

 UUGGGGUUUGGGGUGCAGACAUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-6875 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6875 miRNA Mature ID miR-6875-3p

miRNA Sequence

 AUUCUUCCUGCCCUGGCUCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-6878 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6878 miRNA Mature ID miR-6878-3p

miRNA Sequence

 CUGGCCUCUUCUUUCUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-6881 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6881 miRNA Mature ID miR-6881-3p

miRNA Sequence

 AUCCUCUUUCGUCCUUCCCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-6890 directly targets SLC38A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-5p

miRNA Sequence

 CAUGGGGUAGGGCAGAGUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-877 directly targets SLC38A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

 UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
10 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
11 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.