Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0334 Transporter Info
Gene Name SLC38A7
Transporter Name Putative sodium-coupled neutral amino acid transporter 7
Gene ID
55238
UniProt ID
Q9NVC3
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg05006947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 4.11E-08; Z-score: 1.24E+00

Methylation in Case

 9.13E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg05830473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 4.82E-08; Z-score: 1.56E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg06250214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.38E+00 Statistic Test p-value: 5.76E-08; Z-score: -1.65E+00

Methylation in Case

 1.20E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg06696917)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 6.76E-08; Z-score: -1.28E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg08855361)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 1.55E-07; Z-score: -1.46E+00

Methylation in Case

 7.32E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg11933375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.41E-07; Z-score: 1.23E+00

Methylation in Case

 9.31E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg26758340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.25E-05; Z-score: -7.33E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05876883)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.74E-03; Z-score: 6.52E-01

Methylation in Case

 9.22E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg27182807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 3.36E-09; Z-score: -1.71E+00

Methylation in Case

 7.80E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

 5'UTR (cg06250214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.66E-05; Z-score: -1.85E+01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

 5'UTR (cg11933375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 4.41E-05; Z-score: -1.14E+01

Methylation in Case

 5.11E-02 (Median) Methylation in Control 6.21E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 4.43E-03; Z-score: 5.63E+00

Methylation in Case

 7.21E-01 (Median) Methylation in Control 5.64E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

 3'UTR (cg27182807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.59E-04; Z-score: -4.43E+00

Methylation in Case

 7.70E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in breast cancer [ 3 ]

Location

 5'UTR (cg06250214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.20E-07; Z-score: -1.70E+00

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in breast cancer [ 3 ]

Location

 TSS1500 (cg06073139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.79E+00 Statistic Test p-value: 3.19E-12; Z-score: 2.71E+00

Methylation in Case

 4.53E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in breast cancer [ 3 ]

Location

 TSS1500 (cg04229059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 1.58E-06; Z-score: 1.59E+00

Methylation in Case

 2.11E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in breast cancer [ 3 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.70E-03; Z-score: 7.85E-01

Methylation in Case

 4.54E-01 (Median) Methylation in Control 3.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in breast cancer [ 3 ]

Location

 TSS200 (cg06320982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.69E-02; Z-score: 1.19E-01

Methylation in Case

 8.20E-02 (Median) Methylation in Control 7.93E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg08855361)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.02E-04; Z-score: 7.52E-01

Methylation in Case

 5.27E-02 (Median) Methylation in Control 4.66E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg11933375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.30E-03; Z-score: 8.54E-01

Methylation in Case

 2.16E-02 (Median) Methylation in Control 1.86E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg26758340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.76E-03; Z-score: 3.06E+00

Methylation in Case

 9.38E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg06696917)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.70E-02; Z-score: 5.19E-01

Methylation in Case

 3.18E-02 (Median) Methylation in Control 2.97E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg04229059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 1.30E-04; Z-score: 1.14E+00

Methylation in Case

 2.23E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg06320982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.48E+00 Statistic Test p-value: 2.43E-04; Z-score: 1.01E+00

Methylation in Case

 4.30E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 5'UTR (cg17537007)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.48E-04; Z-score: -1.83E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 Body (cg04491808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 3.11E-05; Z-score: -2.29E+00

Methylation in Case

 5.16E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 Body (cg13939166)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.94E-05; Z-score: -2.48E+00

Methylation in Case

 6.27E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 Body (cg23387310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.41E-05; Z-score: -3.67E+00

Methylation in Case

 5.96E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 Body (cg21557445)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.47E-04; Z-score: -1.09E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

 Body (cg10369665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.47E-03; Z-score: 2.00E+00

Methylation in Case

 6.57E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 5'UTR (cg08855361)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 2.75E-05; Z-score: 1.25E+00

Methylation in Case

 4.39E-02 (Median) Methylation in Control 3.42E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 5'UTR (cg06250214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.10E-03; Z-score: -7.87E-01

Methylation in Case

 9.33E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 5'UTR (cg05006947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 5.04E-03; Z-score: -4.41E-01

Methylation in Case

 5.49E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 5'UTR (cg26758340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 6.94E-03; Z-score: -1.86E-01

Methylation in Case

 9.22E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 5.66E-03; Z-score: -1.01E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 6.21E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg04229059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.10E-02; Z-score: 6.02E-01

Methylation in Case

 3.21E-01 (Median) Methylation in Control 2.86E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

 3'UTR (cg27182807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.74E-04; Z-score: -9.53E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg26758340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 5.90E-03; Z-score: 8.71E-02

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg21384789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 5.25E-11; Z-score: -8.80E+00

Methylation in Case

 6.49E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg06073139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.64E-05; Z-score: -1.04E+00

Methylation in Case

 3.71E-01 (Median) Methylation in Control 4.54E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 3.72E-04; Z-score: -1.11E+00

Methylation in Case

 3.35E-01 (Median) Methylation in Control 4.17E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg04229059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 9.64E-03; Z-score: -8.43E-01

Methylation in Case

 1.83E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg06320982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.19E-02; Z-score: -5.86E-01

Methylation in Case

 7.54E-02 (Median) Methylation in Control 8.89E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg22414192)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.55E+00 Statistic Test p-value: 7.49E-14; Z-score: -9.03E+00

Methylation in Case

 6.08E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in HIV infection [ 8 ]

Location

 5'UTR (cg11933375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 7.19E-03; Z-score: 9.54E-01

Methylation in Case

 7.40E-02 (Median) Methylation in Control 5.96E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in HIV infection [ 8 ]

Location

 5'UTR (cg08855361)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.07E-02; Z-score: 8.63E-01

Methylation in Case

 1.47E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in HIV infection [ 8 ]

Location

 5'UTR (cg05006947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 4.46E-02; Z-score: 7.29E-01

Methylation in Case

 1.29E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in HIV infection [ 8 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.98E-02; Z-score: 4.51E-01

Methylation in Case

 9.45E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A7 in HIV infection [ 8 ]

Location

 TSS200 (cg06320982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 1.49E-06; Z-score: 1.94E+00

Methylation in Case

 1.69E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in lung adenocarcinoma [ 9 ]

Location

 5'UTR (cg05830473)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.42E-02; Z-score: -1.63E+00

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg06073139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.54E-02; Z-score: 2.08E+00

Methylation in Case

 6.29E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

 5'UTR (cg11933375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 7.71E-03; Z-score: -8.13E-01

Methylation in Case

 5.81E-02 (Median) Methylation in Control 6.51E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg06073139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.77E-02; Z-score: 8.00E-01

Methylation in Case

 4.56E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg06320982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 8.39E-04; Z-score: 6.86E-01

Methylation in Case

 5.79E-02 (Median) Methylation in Control 5.14E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

 3'UTR (cg27182807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.26E-03; Z-score: -8.34E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

 5'UTR (cg08855361)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.69E-02; Z-score: 9.69E-02

Methylation in Case

 9.14E-02 (Median) Methylation in Control 8.89E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

 5'UTR (cg05006947)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 3.88E-02; Z-score: 1.79E-01

Methylation in Case

 5.81E-02 (Median) Methylation in Control 5.49E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg04229059)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.40E-02; Z-score: -2.03E-01

Methylation in Case

 4.52E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in depression [ 12 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.27E-02; Z-score: -1.34E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

 TSS1500 (cg03556497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.18E+00 Statistic Test p-value: 2.21E-25; Z-score: 3.99E+00

Methylation in Case

 3.27E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

 TSS1500 (cg07992308)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.24E-03; Z-score: -4.44E-01

Methylation in Case

 5.31E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg10156714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.82E-13; Z-score: -1.80E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

 Body (cg15192909)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.03E-02; Z-score: -3.22E-01

Methylation in Case

 4.85E-01 (Median) Methylation in Control 4.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in panic disorder [ 14 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.69E-02; Z-score: 2.54E-01

Methylation in Case

 3.94E+00 (Median) Methylation in Control 3.83E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A7 in prostate cancer [ 15 ]

Location

 Body (cg14518227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.83E+00 Statistic Test p-value: 1.54E-02; Z-score: -3.46E+00

Methylation in Case

 4.39E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

        108 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7b directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7c directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 let-7d directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 let-7e directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 let-7f directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

 UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 let-7g directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7g miRNA Mature ID let-7g-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUACAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 let-7i directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7i miRNA Mature ID let-7i-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUGCUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-1271 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1271 miRNA Mature ID miR-1271-3p

miRNA Sequence

 AGUGCCUGCUAUGUGCCAGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-1273h directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1273h miRNA Mature ID miR-1273h-5p

miRNA Sequence

 CUGGGAGGUCAAGGCUGCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-141 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-141 miRNA Mature ID miR-141-5p

miRNA Sequence

 CAUCUUCCAGUACAGUGUUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-149 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

 AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-193b directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

 CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-19a directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-5p

miRNA Sequence

 AGUUUUGCAUAGUUGCACUACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-19b-1 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b-1 miRNA Mature ID miR-19b-1-5p

miRNA Sequence

 AGUUUUGCAGGUUUGCAUCCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-19b-2 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b-2 miRNA Mature ID miR-19b-2-5p

miRNA Sequence

 AGUUUUGCAGGUUUGCAUUUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-202 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-202 miRNA Mature ID miR-202-3p

miRNA Sequence

 AGAGGUAUAGGGCAUGGGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-204 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-211 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-214 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-214 miRNA Mature ID miR-214-5p

miRNA Sequence

 UGCCUGUCUACACUUGCUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-29a directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

 ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-30a directly targets SLC38A7 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

 UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-30b directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30b miRNA Mature ID miR-30b-3p

miRNA Sequence

 CUGGGAGGUGGAUGUUUACUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-30b directly targets SLC38A7 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

 UGUAAACAUCCUACACUCAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-30c directly targets SLC38A7 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

 UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-30c-1 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30c-1 miRNA Mature ID miR-30c-1-3p

miRNA Sequence

 CUGGGAGAGGGUUGUUUACUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-30c-2 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30c-2 miRNA Mature ID miR-30c-2-3p

miRNA Sequence

 CUGGGAGAAGGCUGUUUACUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-30d directly targets SLC38A7 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

 UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-30e directly targets SLC38A7 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

 UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-3122 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3122 miRNA Mature ID miR-3122

miRNA Sequence

 GUUGGGACAAGAGGACGGUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-3170 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3170 miRNA Mature ID miR-3170

miRNA Sequence

 CUGGGGUUCUGAGACAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 32

 miR-3187 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3187 miRNA Mature ID miR-3187-3p

miRNA Sequence

 UUGGCCAUGGGGCUGCGCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 33

 miR-323a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-323a miRNA Mature ID miR-323a-5p

miRNA Sequence

 AGGUGGUCCGUGGCGCGUUCGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-3658 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3658 miRNA Mature ID miR-3658

miRNA Sequence

 UUUAAGAAAACACCAUGGAGAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 35

 miR-3689a directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3689a miRNA Mature ID miR-3689a-3p

miRNA Sequence

 CUGGGAGGUGUGAUAUCGUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-3689b directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3689b miRNA Mature ID miR-3689b-3p

miRNA Sequence

 CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-3689c directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3689c miRNA Mature ID miR-3689c

miRNA Sequence

 CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-3913 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3913 miRNA Mature ID miR-3913-5p

miRNA Sequence

 UUUGGGACUGAUCUUGAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-3920 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3920 miRNA Mature ID miR-3920

miRNA Sequence

 ACUGAUUAUCUUAACUCUCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-3929 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

 GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-411 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-411 miRNA Mature ID miR-411-5p

miRNA Sequence

 UAGUAGACCGUAUAGCGUACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-4291 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4291 miRNA Mature ID miR-4291

miRNA Sequence

 UUCAGCAGGAACAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-4310 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4310 miRNA Mature ID miR-4310

miRNA Sequence

 GCAGCAUUCAUGUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-4423 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

 AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 45

 miR-4435 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

 AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-4458 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4458 miRNA Mature ID miR-4458

miRNA Sequence

 AGAGGUAGGUGUGGAAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 47

 miR-4477a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4477a miRNA Mature ID miR-4477a

miRNA Sequence

 CUAUUAAGGACAUUUGUGAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-4478 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

 GAGGCUGAGCUGAGGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-4500 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4500 miRNA Mature ID miR-4500

miRNA Sequence

 UGAGGUAGUAGUUUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 50

 miR-4524a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4524a miRNA Mature ID miR-4524a-3p

miRNA Sequence

 UGAGACAGGCUUAUGCUGCUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-4524b directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4524b miRNA Mature ID miR-4524b-3p

miRNA Sequence

 GAGACAGGUUCAUGCUGCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-4639 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

 UCACUCUCACCUUGCUUUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 53

 miR-4701 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4701 miRNA Mature ID miR-4701-5p

miRNA Sequence

 UUGGCCACCACACCUACCCCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 54

 miR-4721 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4721 miRNA Mature ID miR-4721

miRNA Sequence

 UGAGGGCUCCAGGUGACGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-4728 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

 UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 56

 miR-4755 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

 UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-4755 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

 AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 58

 miR-4781 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

 AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-485 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-5002 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5002 miRNA Mature ID miR-5002-5p

miRNA Sequence

 AAUUUGGUUUCUGAGGCACUUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 61

 miR-5006 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

 UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 62

 miR-516a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-516a miRNA Mature ID miR-516a-5p

miRNA Sequence

 UUCUCGAGGAAAGAAGCACUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 63

 miR-541 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-541 miRNA Mature ID miR-541-3p

miRNA Sequence

 UGGUGGGCACAGAAUCUGGACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-548s directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548s miRNA Mature ID miR-548s

miRNA Sequence

 AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 65

 miR-550a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-550a miRNA Mature ID miR-550a-5p

miRNA Sequence

 AGUGCCUGAGGGAGUAAGAGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-588 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-588 miRNA Mature ID miR-588

miRNA Sequence

 UUGGCCACAAUGGGUUAGAAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

 miR-615 directly targets SLC38A7 [ 22 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 68

 miR-623 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-623 miRNA Mature ID miR-623

miRNA Sequence

 AUCCCUUGCAGGGGCUGUUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 69

 miR-6501 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

 AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 70

 miR-6513 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6513 miRNA Mature ID miR-6513-5p

miRNA Sequence

 UUUGGGAUUGACGCCACAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-6514 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6514 miRNA Mature ID miR-6514-3p

miRNA Sequence

 CUGCCUGUUCUUCCACUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 72

 miR-654 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-654 miRNA Mature ID miR-654-5p

miRNA Sequence

 UGGUGGGCCGCAGAACAUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 73

 miR-665 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 74

 miR-6741 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6741 miRNA Mature ID miR-6741-5p

miRNA Sequence

 GUGGGUGCUGGUGGGAGCCGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 75

 miR-6748 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6748 miRNA Mature ID miR-6748-5p

miRNA Sequence

 UGUGGGUGGGAAGGACUGGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 76

 miR-6769a directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6769a miRNA Mature ID miR-6769a-5p

miRNA Sequence

 AGGUGGGUAUGGAGGAGCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 77

 miR-6769b directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6769b miRNA Mature ID miR-6769b-5p

miRNA Sequence

 UGGUGGGUGGGGAGGAGAAGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 78

 miR-6779 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6779 miRNA Mature ID miR-6779-5p

miRNA Sequence

 CUGGGAGGGGCUGGGUUUGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 79

 miR-6780a directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6780a miRNA Mature ID miR-6780a-5p

miRNA Sequence

 UUGGGAGGGAAGACAGCUGGAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 80

 miR-6785 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

 UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 81

 miR-6788 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6788 miRNA Mature ID miR-6788-5p

miRNA Sequence

 CUGGGAGAAGAGUGGUGAAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 82

 miR-6794 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6794 miRNA Mature ID miR-6794-3p

miRNA Sequence

 CUCACUCUCAGUCCCUCCCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 83

 miR-6799 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

 GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 84

 miR-6811 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6811 miRNA Mature ID miR-6811-3p

miRNA Sequence

 AGCCUGUGCUUGUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 85

 miR-6823 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6823 miRNA Mature ID miR-6823-5p

miRNA Sequence

 UCAGGGUUGGUAGGGGUUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 86

 miR-6832 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

 AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 87

 miR-6855 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6855 miRNA Mature ID miR-6855-5p

miRNA Sequence

 UUGGGGUUUGGGGUGCAGACAUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 88

 miR-6880 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

 UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 89

 miR-6883 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

 AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 90

 miR-6884 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

 AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 91

 miR-6888 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6888 miRNA Mature ID miR-6888-5p

miRNA Sequence

 AAGGAGAUGCUCAGGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 92

 miR-6890 directly targets SLC38A7 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-5p

miRNA Sequence

 CAUGGGGUAGGGCAGAGUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 93

 miR-6894 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6894 miRNA Mature ID miR-6894-5p

miRNA Sequence

 AGGAGGAUGGAGAGCUGGGCCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 94

 miR-7106 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

 UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 95

 miR-7154 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7154 miRNA Mature ID miR-7154-3p

miRNA Sequence

 AGGAGGACAAGUUGUGGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 96

 miR-7157 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7157 miRNA Mature ID miR-7157-5p

miRNA Sequence

 UCAGCAUUCAUUGGCACCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 97

 miR-7160 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

 UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 98

 miR-7162 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7162 miRNA Mature ID miR-7162-3p

miRNA Sequence

 UCUGAGGUGGAACAGCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 99

 miR-744 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

 CUGUUGCCACUAACCUCAACCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 100

 miR-765 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-765 miRNA Mature ID miR-765

miRNA Sequence

 UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 101

 miR-766 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-766 miRNA Mature ID miR-766-5p

miRNA Sequence

 AGGAGGAAUUGGUGCUGGUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 102

 miR-7847 directly targets SLC38A7 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

 CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 103

 miR-7856 directly targets SLC38A7 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7856 miRNA Mature ID miR-7856-5p

miRNA Sequence

 UUUUAAGGACACUGAGGGAUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 104

 miR-7977 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

 UUCCCAGCCAACGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 105

 miR-876 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-876 miRNA Mature ID miR-876-3p

miRNA Sequence

 UGGUGGUUUACAAAGUAAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 106

 miR-887 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-887 miRNA Mature ID miR-887-5p

miRNA Sequence

 CUUGGGAGCCCUGUUAGACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 107

 miR-92a-2 directly targets SLC38A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-92a-2 miRNA Mature ID miR-92a-2-5p

miRNA Sequence

 GGGUGGGGAUUUGUUGCAUUAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 108

 miR-98 directly targets SLC38A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
17 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
19 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
20 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
22 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.