Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0336 Transporter Info
Gene Name SLC38A9
Transporter Name Sodium-coupled neutral amino acid transporter 9
Gene ID
153129
UniProt ID
Q8NBW4
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg04401436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.15E-08; Z-score: -1.37E+00

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg05146599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.86E+00 Statistic Test p-value: 4.49E-08; Z-score: -2.11E+00

Methylation in Case

 1.31E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13598790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 5.80E-07; Z-score: 1.11E+00

Methylation in Case

 9.41E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg18034294)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 2.21E-06; Z-score: -1.28E+00

Methylation in Case

 5.29E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05462905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.48E-03; Z-score: -6.64E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg07042489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.30E-03; Z-score: -7.56E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.73E-03; Z-score: -5.05E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg13589588)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.72E-02; Z-score: 3.98E-01

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg05146599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.47E-04; Z-score: -5.62E+00

Methylation in Case

 7.38E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg13598790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 1.75E-02; Z-score: -1.07E+00

Methylation in Case

 3.81E-02 (Median) Methylation in Control 4.36E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg18034294)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.35E-02; Z-score: -1.23E+00

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11493924)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 5.09E-04; Z-score: -2.71E+00

Methylation in Case

 5.86E-02 (Median) Methylation in Control 7.24E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11466815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 3.93E-02; Z-score: -1.09E+00

Methylation in Case

 1.83E-02 (Median) Methylation in Control 2.21E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 TSS200 (cg10968375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 2.42E-02; Z-score: -1.20E+00

Methylation in Case

 2.01E-02 (Median) Methylation in Control 2.89E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 Body (cg07042489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.45E-03; Z-score: -3.55E+00

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 Body (cg05462905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.27E-03; Z-score: -2.88E+00

Methylation in Case

 6.73E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 Body (cg24749564)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.29E-03; Z-score: 2.20E+00

Methylation in Case

 8.16E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 Body (cg27622900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.90E-03; Z-score: -1.89E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.27E-02; Z-score: 9.31E-01

Methylation in Case

 4.28E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 5'UTR (cg05146599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 8.04E-05; Z-score: 1.55E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 5'UTR (cg18034294)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.23E-03; Z-score: -4.28E-01

Methylation in Case

 8.81E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 5'UTR (cg13598790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.07E-02; Z-score: -4.33E-01

Methylation in Case

 2.77E-02 (Median) Methylation in Control 3.10E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 TSS1500 (cg11493924)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 8.90E-03; Z-score: -3.30E-01

Methylation in Case

 5.87E-02 (Median) Methylation in Control 6.68E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 TSS1500 (cg09277365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 4.36E-02; Z-score: -5.28E-01

Methylation in Case

 4.80E-02 (Median) Methylation in Control 5.58E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 TSS200 (cg10968375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 3.13E-02; Z-score: -5.84E-01

Methylation in Case

 9.94E-03 (Median) Methylation in Control 1.40E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 TSS200 (cg12824106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 3.20E-02; Z-score: -3.71E-01

Methylation in Case

 5.80E-03 (Median) Methylation in Control 7.47E-03 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.78E+00 Statistic Test p-value: 1.47E-18; Z-score: 3.24E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg07042489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.60E-04; Z-score: -7.83E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.58E-03; Z-score: 9.00E-01

Methylation in Case

 4.77E-01 (Median) Methylation in Control 4.12E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg13589588)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.19E-03; Z-score: -6.61E-01

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg27622900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.53E-03; Z-score: -7.33E-01

Methylation in Case

 7.71E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC38A9 in breast cancer [ 3 ]

Location

 Body (cg24749564)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.76E-02; Z-score: 4.40E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg04401436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.68E-02; Z-score: 3.05E-01

Methylation in Case

 2.71E-02 (Median) Methylation in Control 2.54E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg11466815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 9.07E-03; Z-score: 5.38E-01

Methylation in Case

 2.52E-02 (Median) Methylation in Control 2.40E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg11283154)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 8.79E-03; Z-score: 6.50E-01

Methylation in Case

 2.36E-02 (Median) Methylation in Control 2.23E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg07397574)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.53E-02; Z-score: 2.82E-01

Methylation in Case

 1.72E-02 (Median) Methylation in Control 1.67E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg12824106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.68E-02; Z-score: 1.93E-01

Methylation in Case

 1.09E-02 (Median) Methylation in Control 1.07E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg09554558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.08E-02; Z-score: 3.25E-01

Methylation in Case

 1.36E-02 (Median) Methylation in Control 1.30E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg10968375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.09E-02; Z-score: 5.38E-01

Methylation in Case

 1.32E-02 (Median) Methylation in Control 1.23E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

 5'UTR (cg13598790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.64E-03; Z-score: 6.53E-01

Methylation in Case

 2.01E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

 TSS200 (cg10968375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 2.45E-03; Z-score: 5.68E-01

Methylation in Case

 1.10E-02 (Median) Methylation in Control 9.34E-03 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

 TSS200 (cg09200496)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.94E-02; Z-score: -5.35E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

 Body (cg27622900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.29E-06; Z-score: -1.59E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.30E-05; Z-score: 1.36E+00

Methylation in Case

 6.52E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg05146599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.00E-05; Z-score: -1.17E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 4.51E-08; Z-score: -1.36E+00

Methylation in Case

 2.59E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg07042489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 4.51E-08; Z-score: -1.35E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 4.44E-07; Z-score: -1.44E+00

Methylation in Case

 2.37E-01 (Median) Methylation in Control 3.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg24749564)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.05E-03; Z-score: -4.70E-01

Methylation in Case

 8.04E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 5'UTR (cg18034294)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.33E-02; Z-score: 7.86E-01

Methylation in Case

 9.52E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 TSS1500 (cg11493924)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.34E-02; Z-score: 5.97E-01

Methylation in Case

 6.95E-02 (Median) Methylation in Control 6.16E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 TSS1500 (cg03329536)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.50E-02; Z-score: -3.25E-01

Methylation in Case

 5.34E-02 (Median) Methylation in Control 5.71E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 TSS200 (cg12824106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 6.35E-03; Z-score: 7.59E-01

Methylation in Case

 7.25E-03 (Median) Methylation in Control 4.66E-03 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 TSS200 (cg11283154)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.48E+00 Statistic Test p-value: 3.35E-02; Z-score: 7.00E-01

Methylation in Case

 1.38E-02 (Median) Methylation in Control 9.37E-03 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 3.40E-06; Z-score: 1.94E+00

Methylation in Case

 7.94E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 Body (cg27622900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.08E-03; Z-score: 6.29E-01

Methylation in Case

 8.78E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in HIV infection [ 7 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.24E-02; Z-score: 3.12E-01

Methylation in Case

 7.81E-01 (Median) Methylation in Control 7.67E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 5'UTR (cg21660392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.11E-03; Z-score: -7.19E-01

Methylation in Case

 7.54E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 5'UTR (cg08240652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.67E-03; Z-score: 1.19E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 5'UTR (cg12484332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.95E-02; Z-score: -1.51E-01

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg13161658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.02E+00 Statistic Test p-value: 1.38E-05; Z-score: 1.43E+00

Methylation in Case

 3.23E-01 (Median) Methylation in Control 1.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg18584905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.89E-02; Z-score: -1.22E+00

Methylation in Case

 1.75E-01 (Median) Methylation in Control 2.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg03483626)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 2.09E-02; Z-score: 3.87E-01

Methylation in Case

 5.28E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg22364668)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.71E-07; Z-score: 2.89E-01

Methylation in Case

 4.90E-02 (Median) Methylation in Control 4.57E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg17344085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.33E-02; Z-score: -5.96E-01

Methylation in Case

 3.03E-02 (Median) Methylation in Control 3.37E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg03067613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 8.57E-05; Z-score: 1.25E+00

Methylation in Case

 8.43E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg15531450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 3.16E-04; Z-score: 9.13E-01

Methylation in Case

 5.40E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg02793733)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.77E-03; Z-score: -2.91E-01

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg19503341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.09E-02; Z-score: 7.48E-01

Methylation in Case

 4.87E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg17461670)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.32E-02; Z-score: -3.69E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

 5'UTR (cg04401436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.77E-02; Z-score: -7.40E-02

Methylation in Case

 9.11E-02 (Median) Methylation in Control 9.25E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg09277365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.38E-02; Z-score: -1.09E-01

Methylation in Case

 7.65E-02 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg21173440)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.44E-02; Z-score: 5.96E-02

Methylation in Case

 1.86E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

 Body (cg27622900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.30E-03; Z-score: -2.90E-01

Methylation in Case

 8.57E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

 TSS1500 (cg11826452)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.30E-03; Z-score: -8.62E-01

Methylation in Case

 4.82E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

 TSS1500 (cg14282904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.46E+00 Statistic Test p-value: 1.36E-03; Z-score: 1.95E+00

Methylation in Case

 1.95E-01 (Median) Methylation in Control 7.92E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

 1stExon (cg16163981)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.89E-03; Z-score: 1.12E+00

Methylation in Case

 4.27E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

 3'UTR (cg03954999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 2.26E-03; Z-score: -2.94E+00

Methylation in Case

 7.32E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 TSS1500 (cg11493924)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 7.53E-08; Z-score: -8.60E-01

Methylation in Case

 6.67E-02 (Median) Methylation in Control 8.28E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 TSS1500 (cg09277365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.12E-03; Z-score: -4.30E-01

Methylation in Case

 5.72E-02 (Median) Methylation in Control 6.31E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 TSS1500 (cg03329536)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.74E-02; Z-score: -6.27E-01

Methylation in Case

 5.71E-02 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 TSS200 (cg10968375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 3.43E-05; Z-score: -6.86E-01

Methylation in Case

 4.54E-02 (Median) Methylation in Control 5.02E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 TSS200 (cg09554558)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.51E-03; Z-score: -6.57E-01

Methylation in Case

 4.70E-02 (Median) Methylation in Control 5.10E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 1.78E-20; Z-score: -4.54E+00

Methylation in Case

 4.91E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 Body (cg24749564)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.06E-07; Z-score: -1.27E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 Body (cg05462905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.73E-03; Z-score: -5.69E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 3.72E-02; Z-score: 3.77E-01

Methylation in Case

 4.02E-01 (Median) Methylation in Control 3.79E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

 TSS200 (cg07920064)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.44E-03; Z-score: 3.39E+00

Methylation in Case

 4.96E-02 (Median) Methylation in Control 3.51E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

 Body (cg00502885)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 6.64E-04; Z-score: 5.27E+00

Methylation in Case

 9.14E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

 Body (cg10062193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.92E+00 Statistic Test p-value: 7.22E-04; Z-score: 5.15E+00

Methylation in Case

 7.96E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

 3'UTR (cg03825810)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 5.06E-03; Z-score: -6.52E+00

Methylation in Case

 5.14E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in lung adenocarcinoma [ 13 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 1.10E-03; Z-score: 2.95E+00

Methylation in Case

 6.01E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC38A9 in panic disorder [ 14 ]

Location

 Body (cg05462905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 7.29E-03; Z-score: -2.28E-01

Methylation in Case

 5.42E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          72 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106a directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-3p

miRNA Sequence

 CUGCAAUGUAAGCACUUCUUAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-122 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

 UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-125a directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-125a miRNA Mature ID miR-125a-3p

miRNA Sequence

 ACAGGUGAGGUUCUUGGGAGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-1264 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1264 miRNA Mature ID miR-1264

miRNA Sequence

 CAAGUCUUAUUUGAGCACCUGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-129 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

 CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1304 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

 UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-130a directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

 CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-130b directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-145 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-145 miRNA Mature ID miR-145-3p

miRNA Sequence

 GGAUUCCUGGAAAUACUGUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-183 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

 UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-1911 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1911 miRNA Mature ID miR-1911-5p

miRNA Sequence

 UGAGUACCGCCAUGUCUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-1972 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

 UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-1976 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-2113 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2113 miRNA Mature ID miR-2113

miRNA Sequence

 AUUUGUGCUUGGCUCUGUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-24-1 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-24-1 miRNA Mature ID miR-24-1-5p

miRNA Sequence

 UGCCUACUGAGCUGAUAUCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-24-2 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-24-2 miRNA Mature ID miR-24-2-5p

miRNA Sequence

 UGCCUACUGAGCUGAAACACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-301a directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

 CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-301b directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

 CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-3135b directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

 GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-3194 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3194 miRNA Mature ID miR-3194-5p

miRNA Sequence

 GGCCAGCCACCAGGAGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-330 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

 GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-3652 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

 CGGCUGGAGGUGUGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-3654 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3654 miRNA Mature ID miR-3654

miRNA Sequence

 GACUGGACAAGCUGAGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-3666 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

 CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-3675 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3675 miRNA Mature ID miR-3675-3p

miRNA Sequence

 CAUCUCUAAGGAACUCCCCCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-371a directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

 ACUCAAACUGUGGGGGCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-371b directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

 ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-372 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

 CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-373 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

 ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-3934 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3934 miRNA Mature ID miR-3934-5p

miRNA Sequence

 UCAGGUGUGGAAACUGAGGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-4295 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

 CAGUGCAAUGUUUUCCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-4430 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

 AGGCUGGAGUGAGCGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-4474 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4474 miRNA Mature ID miR-4474-5p

miRNA Sequence

 UUAGUCUCAUGAUCAGACACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-4520 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4520 miRNA Mature ID miR-4520-3p

miRNA Sequence

 UUGGACAGAAAACACGCAGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-454 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

 UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-4638 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4638 miRNA Mature ID miR-4638-3p

miRNA Sequence

 CCUGGACACCGCUCAGCCGGCCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-4659a directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4659a miRNA Mature ID miR-4659a-3p

miRNA Sequence

 UUUCUUCUUAGACAUGGCAACG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-4659b directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4659b miRNA Mature ID miR-4659b-3p

miRNA Sequence

 UUUCUUCUUAGACAUGGCAGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-4661 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4661 miRNA Mature ID miR-4661-3p

miRNA Sequence

 CAGGAUCCACAGAGCUAGUCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-4695 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4695 miRNA Mature ID miR-4695-3p

miRNA Sequence

 UGAUCUCACCGCUGCCUCCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-4722 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-4755 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

 AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-4772 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

 CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-4775 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4775 miRNA Mature ID miR-4775

miRNA Sequence

 UUAAUUUUUUGUUUCGGUCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-4778 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4778 miRNA Mature ID miR-4778-3p

miRNA Sequence

 UCUUCUUCCUUUGCAGAGUUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-488 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-488 miRNA Mature ID miR-488-5p

miRNA Sequence

 CCCAGAUAAUGGCACUCUCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-500a directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-500a miRNA Mature ID miR-500a-5p

miRNA Sequence

 UAAUCCUUGCUACCUGGGUGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-501 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-501 miRNA Mature ID miR-501-5p

miRNA Sequence

 AAUCCUUUGUCCCUGGGUGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-5010 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5010 miRNA Mature ID miR-5010-3p

miRNA Sequence

 UUUUGUGUCUCCCAUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-504 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

 GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-5197 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

 CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-519d directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-5p

miRNA Sequence

 CCUCCAAAGGGAAGCGCUUUCUGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-548aa directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-548ap directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

 AAAAACCACAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-548as directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

 UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-548at directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548at miRNA Mature ID miR-548at-3p

miRNA Sequence

 CAAAACCGCAGUAACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-548ay directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ay miRNA Mature ID miR-548ay-3p

miRNA Sequence

 CAAAACCGCGAUUACUCUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-548t directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-551b directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-551b miRNA Mature ID miR-551b-5p

miRNA Sequence

 GAAAUCAAGCGUGGGUGAGACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 60

 miR-564 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-564 miRNA Mature ID miR-564

miRNA Sequence

 AGGCACGGUGUCAGCAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-605 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

 UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 62

 miR-616 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

 ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 63

 miR-6727 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-6736 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6736 miRNA Mature ID miR-6736-3p

miRNA Sequence

 UCAGCUCCUCUCUACCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 65

 miR-6747 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-6787 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6787 miRNA Mature ID miR-6787-3p

miRNA Sequence

 UCUCAGCUGCUGCCCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 67

 miR-6835 directly targets SLC38A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 68

 miR-6875 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6875 miRNA Mature ID miR-6875-3p

miRNA Sequence

 AUUCUUCCUGCCCUGGCUCCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 69

 miR-6890 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

 CCACUGCCUAUGCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 70

 miR-764 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-764 miRNA Mature ID miR-764

miRNA Sequence

 GCAGGUGCUCACUUGUCCUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-8063 directly targets SLC38A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8063 miRNA Mature ID miR-8063

miRNA Sequence

 UCAAAAUCAGGAGUCGGGGCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 72

 miR-8086 directly targets SLC38A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8086 miRNA Mature ID miR-8086

miRNA Sequence

 UGCUAGUCUGGACUGAUAUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
17 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.