Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0337 Transporter Info
Gene Name SLC39A1
Transporter Name Zinc transporter ZIP1
Gene ID
27173
UniProt ID
Q9NY26
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg08623548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.42E-07; Z-score: -1.20E+00

Methylation in Case

 5.89E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10624480)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.21E-07; Z-score: -1.20E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg11073833)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 3.01E-07; Z-score: 1.11E+00

Methylation in Case

 8.31E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 3.33E-07; Z-score: 1.12E+00

Methylation in Case

 2.32E-01 (Median) Methylation in Control 1.58E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg14747580)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 9.81E-07; Z-score: -1.15E+00

Methylation in Case

 6.43E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg15601229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.24E-06; Z-score: 1.02E+00

Methylation in Case

 7.36E-01 (Median) Methylation in Control 6.43E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg16414271)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.76E-06; Z-score: -1.08E+00

Methylation in Case

 5.39E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg23257110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 6.80E-06; Z-score: -1.08E+00

Methylation in Case

 8.57E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.79E+00 Statistic Test p-value: 9.36E-06; Z-score: -1.63E+00

Methylation in Case

 4.60E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05464581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.50E-03; Z-score: 3.30E-01

Methylation in Case

 8.43E-02 (Median) Methylation in Control 7.11E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC39A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg09079613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 9.22E-03; Z-score: -4.02E-01

Methylation in Case

 5.59E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 1.16E-08; Z-score: -9.17E+00

Methylation in Case

 6.26E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.57E-03; Z-score: -4.34E+00

Methylation in Case

 2.75E-02 (Median) Methylation in Control 3.36E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in bladder cancer [ 2 ]

Location

 Body (cg09079613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 7.65E-04; Z-score: 5.23E+00

Methylation in Case

 6.04E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in breast cancer [ 3 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 3.27E-03; Z-score: -1.13E+00

Methylation in Case

 6.31E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in breast cancer [ 3 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.08E-02; Z-score: 4.58E-01

Methylation in Case

 3.28E-02 (Median) Methylation in Control 2.79E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in breast cancer [ 3 ]

Location

 Body (cg09079613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.16E-22; Z-score: 3.71E+00

Methylation in Case

 5.68E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in breast cancer [ 3 ]

Location

 Body (cg05464581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 6.84E-03; Z-score: 6.58E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.84E-05; Z-score: -1.65E+00

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.53E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.71E-04; Z-score: 6.14E-01

Methylation in Case

 2.16E-02 (Median) Methylation in Control 2.00E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg15601229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.63E-02; Z-score: 4.03E-01

Methylation in Case

 2.66E-02 (Median) Methylation in Control 2.45E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg08623548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.39E-02; Z-score: 5.19E-01

Methylation in Case

 5.50E-02 (Median) Methylation in Control 5.05E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in colon adenocarcinoma [ 5 ]

Location

 5'UTR (cg03861633)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.81E-05; Z-score: -1.42E+00

Methylation in Case

 5.61E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in colon adenocarcinoma [ 5 ]

Location

 Body (cg05031424)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.81E-05; Z-score: -3.05E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in colon adenocarcinoma [ 5 ]

Location

 Body (cg07100560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.36E-03; Z-score: -1.53E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in colon adenocarcinoma [ 5 ]

Location

 Body (cg23537887)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 3.46E-03; Z-score: 1.24E+00

Methylation in Case

 2.79E-01 (Median) Methylation in Control 2.30E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in colorectal cancer [ 6 ]

Location

 5'UTR (cg10624480)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.04E-02; Z-score: -2.45E-01

Methylation in Case

 5.73E-02 (Median) Methylation in Control 5.95E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in colorectal cancer [ 6 ]

Location

 Body (cg09079613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.43E-03; Z-score: -1.11E+00

Methylation in Case

 7.94E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in colorectal cancer [ 6 ]

Location

 Body (cg05464581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.63E-02; Z-score: -5.37E-01

Methylation in Case

 9.25E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg08623548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.38E-02; Z-score: -6.54E-01

Methylation in Case

 7.39E-02 (Median) Methylation in Control 9.69E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.47E-02; Z-score: -4.21E-01

Methylation in Case

 3.48E-02 (Median) Methylation in Control 4.13E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg07873449)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 3.44E-18; Z-score: -8.89E+00

Methylation in Case

 6.13E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in HIV infection [ 8 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.32E-05; Z-score: -3.11E+00

Methylation in Case

 7.34E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in HIV infection [ 8 ]

Location

 5'UTR (cg08623548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.82E+00 Statistic Test p-value: 1.01E-04; Z-score: 1.27E+00

Methylation in Case

 1.37E-01 (Median) Methylation in Control 7.53E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in HIV infection [ 8 ]

Location

 5'UTR (cg11411904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 1.26E-03; Z-score: 1.16E+00

Methylation in Case

 3.88E-02 (Median) Methylation in Control 2.72E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in HIV infection [ 8 ]

Location

 Body (cg09079613)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.70E-04; Z-score: 6.36E-01

Methylation in Case

 8.41E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC39A1 in HIV infection [ 8 ]

Location

 Body (cg05464581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.24E-03; Z-score: -7.58E-01

Methylation in Case

 8.81E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in lung adenocarcinoma [ 9 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.10E-03; Z-score: -2.41E+00

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in panic disorder [ 10 ]

Location

 5'UTR (cg08623548)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.53E-01 Statistic Test p-value: 1.77E-03; Z-score: -6.73E-01

Methylation in Case

 -3.95E+00 (Median) Methylation in Control -3.76E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in panic disorder [ 10 ]

Location

 5'UTR (cg25064552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 7.55E-03; Z-score: 4.96E-01

Methylation in Case

 2.63E+00 (Median) Methylation in Control 2.41E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in panic disorder [ 10 ]

Location

 5'UTR (cg16414271)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.72E-01 Statistic Test p-value: 1.53E-02; Z-score: 4.89E-01

Methylation in Case

 -4.06E+00 (Median) Methylation in Control -4.17E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC39A1 in panic disorder [ 10 ]

Location

 Body (cg05464581)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.57E-02; Z-score: 2.81E-01

Methylation in Case

 3.13E+00 (Median) Methylation in Control 2.98E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in papillary thyroid cancer [ 11 ]

Location

 5'UTR (cg16414271)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.39E-02; Z-score: -3.91E-01

Methylation in Case

 8.78E-02 (Median) Methylation in Control 9.25E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in prostate cancer [ 12 ]

Location

 5'UTR (cg04529938)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.99E+00 Statistic Test p-value: 2.95E-03; Z-score: 2.06E+01

Methylation in Case

 7.21E-01 (Median) Methylation in Control 3.63E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in systemic lupus erythematosus [ 13 ]

Location

 5'UTR (cg14747580)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.30E-02; Z-score: -7.86E-02

Methylation in Case

 8.00E-02 (Median) Methylation in Control 8.13E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in systemic lupus erythematosus [ 13 ]

Location

 5'UTR (cg15601229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.56E-02; Z-score: -5.45E-02

Methylation in Case

 8.58E-02 (Median) Methylation in Control 8.68E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A1 in pancretic ductal adenocarcinoma [ 14 ]

Location

 TSS200 (cg26763542)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 6.76E-03; Z-score: 1.06E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A1 in pancretic ductal adenocarcinoma [ 14 ]

Location

 Body (cg26675219)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 4.52E-04; Z-score: -5.13E-01

Methylation in Case

 4.98E-02 (Median) Methylation in Control 5.47E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A1 in pancretic ductal adenocarcinoma [ 14 ]

Location

 Body (cg18856043)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.26E-03; Z-score: -6.20E-01

Methylation in Case

 4.20E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          29 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1227 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1227 miRNA Mature ID miR-1227-5p

miRNA Sequence

 GUGGGGCCAGGCGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1231 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1231 miRNA Mature ID miR-1231

miRNA Sequence

 GUGUCUGGGCGGACAGCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-18a directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-18a miRNA Mature ID miR-18a-3p

miRNA Sequence

 ACUGCCCUAAGUGCUCCUUCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1913 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1913 miRNA Mature ID miR-1913

miRNA Sequence

 UCUGCCCCCUCCGCUGCUGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-192 directly targets SLC39A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-215 directly targets SLC39A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-2276 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2276 miRNA Mature ID miR-2276-5p

miRNA Sequence

 GCCCUCUGUCACCUUGCAGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-2682 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2682 miRNA Mature ID miR-2682-3p

miRNA Sequence

 CGCCUCUUCAGCGCUGUCUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-30c directly targets SLC39A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

 UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3194 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3194 miRNA Mature ID miR-3194-5p

miRNA Sequence

 GGCCAGCCACCAGGAGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-324 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-324 miRNA Mature ID miR-324-3p

miRNA Sequence

 CCCACUGCCCCAGGUGCUGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-346 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-346 miRNA Mature ID miR-346

miRNA Sequence

 UGUCUGCCCGCAUGCCUGCCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3655 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3655 miRNA Mature ID miR-3655

miRNA Sequence

 GCUUGUCGCUGCGGUGUUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4288 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4288 miRNA Mature ID miR-4288

miRNA Sequence

 UUGUCUGCUGAGUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4515 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4515 miRNA Mature ID miR-4515

miRNA Sequence

 AGGACUGGACUCCCGGCAGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4640 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4640 miRNA Mature ID miR-4640-5p

miRNA Sequence

 UGGGCCAGGGAGCAGCUGGUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4726 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4726 miRNA Mature ID miR-4726-5p

miRNA Sequence

 AGGGCCAGAGGAGCCUGGAGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-632 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-632 miRNA Mature ID miR-632

miRNA Sequence

 GUGUCUGCUUCCUGUGGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-642a directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-642a miRNA Mature ID miR-642a-5p

miRNA Sequence

 GUCCCUCUCCAAAUGUGUCUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-6758 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6758 miRNA Mature ID miR-6758-3p

miRNA Sequence

 ACUCAUUCUCCUCUGUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-6762 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6762 miRNA Mature ID miR-6762-5p

miRNA Sequence

 CGGGGCCAUGGAGCAGCCUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-6781 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6781 miRNA Mature ID miR-6781-3p

miRNA Sequence

 UGCCUCUUUUCCACGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-6788 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6788 miRNA Mature ID miR-6788-3p

miRNA Sequence

 UUCGCCACUUCCCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-6819 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6819 miRNA Mature ID miR-6819-3p

miRNA Sequence

 AAGCCUCUGUCCCCACCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-6845 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6845 miRNA Mature ID miR-6845-5p

miRNA Sequence

 CGGGGCCAGAGCAGAGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-6877 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6877 miRNA Mature ID miR-6877-3p

miRNA Sequence

 CAGCCUCUGCCCUUGGCCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-6892 directly targets SLC39A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-877 directly targets SLC39A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-5p

miRNA Sequence

 GUAGAGGAGAUGGCGCAGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-96 directly targets SLC39A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-96 miRNA Mature ID miR-96-5p

miRNA Sequence

 UUUGGCACUAGCACAUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
15 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
16 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
18 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.