Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0340 Transporter Info
Gene Name	SLC39A12
Transporter Name	Zinc transporter ZIP12
Gene ID	221074
UniProt ID	Q504Y0

Epigenetic Regulations of This DT (EGR)
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-335 directly targets SLC39A12			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Methylation
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant/significant hypermethylation of SLC39A12 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.04E-05; Fold-change: -0.533239257; Z-score: -1.312540043
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 7.98E-22; Fold-change: -0.530778583; Z-score: -5.493836972
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC39A12 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.005236847; Fold-change: 0.268692544; Z-score: 1.071928819
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC39A12 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.07E-09; Fold-change: -0.278409532; Z-score: -4.299163713
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC39A12 in ovarian cancer than that in healthy individual
Studied Phenotype	Ovarian cancer [ICD-11:2C73]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.007008701; Fold-change: -0.229390013; Z-score: -0.988024953
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC39A12 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.29E-44; Fold-change: 0.442248755; Z-score: 2.459777053
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Meningioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC39A12 in meningioma than that in healthy individual
Studied Phenotype	Meningioma [ICD-11:2A01.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.27E-50; Fold-change: 0.387698666; Z-score: 2.115105399
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC39A12 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.57E-20; Fold-change: -0.554433153; Z-score: -9.642672808
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Uterine carcinosarcoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC39A12 in uterine carcinosarcoma than that in healthy individual
Studied Phenotype	Uterine carcinosarcoma [ICD-11:2B5F]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.003403225; Fold-change: -0.324159984; Z-score: -1.392010996
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual