Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0341 Transporter Info | ||||
Gene Name | SLC39A13 | ||||
Transporter Name | Zinc transporter ZIP13 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1225 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1225 | miRNA Mature ID | miR-1225-3p | ||
miRNA Sequence |
UGAGCCCCUGUGCCGCCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1233 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1233 | miRNA Mature ID | miR-1233-3p | ||
miRNA Sequence |
UGAGCCCUGUCCUCCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-18a directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-18a | miRNA Mature ID | miR-18a-3p | ||
miRNA Sequence |
ACUGCCCUAAGUGCUCCUUCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-2355 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2355 | miRNA Mature ID | miR-2355-5p | ||
miRNA Sequence |
AUCCCCAGAUACAAUGGACAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-3943 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3943 | miRNA Mature ID | miR-3943 | ||
miRNA Sequence |
UAGCCCCCAGGCUUCACUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-4286 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4286 | miRNA Mature ID | miR-4286 | ||
miRNA Sequence |
ACCCCACUCCUGGUACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-4313 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4313 | miRNA Mature ID | miR-4313 | ||
miRNA Sequence |
AGCCCCCUGGCCCCAAACCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-484 directly targets SLC39A13 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-6734 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6734 | miRNA Mature ID | miR-6734-3p | ||
miRNA Sequence |
CCCUUCCCUCACUCUUCUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-6752 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6752 | miRNA Mature ID | miR-6752-3p | ||
miRNA Sequence |
UCCCUGCCCCCAUACUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-6801 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6801 | miRNA Mature ID | miR-6801-3p | ||
miRNA Sequence |
ACCCCUGCCACUCACUGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-6810 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6810 | miRNA Mature ID | miR-6810-3p | ||
miRNA Sequence |
UCCCCUGCUCCCUUGUUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-6886 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6886 | miRNA Mature ID | miR-6886-3p | ||
miRNA Sequence |
UGCCCUUCUCUCCUCCUGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-938 directly targets SLC39A13 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-938 | miRNA Mature ID | miR-938 | ||
miRNA Sequence |
UGCCCUUAAAGGUGAACCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC39A13 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.00084575; Fold-change: -0.214684362; Z-score: -6.087604965 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC39A13 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.10E-14; Fold-change: -0.453294648; Z-score: -11.94747273 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.