Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0344 Transporter Info | ||||
Gene Name | SLC39A3 | ||||
Transporter Name | Zinc transporter ZIP3 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Colon cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS200 (cg10951120) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.96E+00 | Statistic Test | p-value: 9.96E-04; Z-score: 3.44E+00 | ||
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 6.57E-02 (Median) | ||
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC39A3 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS200 (cg15014549) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 4.56E-03; Z-score: 2.13E+00 | ||
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
Body (cg06262842) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.26E-03; Z-score: 3.68E-01 | ||
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
Body (cg08122172) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 5.35E-03; Z-score: 5.49E-01 | ||
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
3'UTR (cg07942762) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.85E-13; Z-score: -1.98E+00 | ||
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.67E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
Body (cg17827583) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 6.28E-03; Z-score: -4.07E-01 | ||
Methylation in Case |
9.77E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC39A3 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
Body (cg06262842) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.16E-02; Z-score: -3.07E-01 | ||
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg06262842) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.29E-02; Z-score: 4.51E-01 | ||
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in HIV infection | [ 5 ] | |||
Location |
Body (cg06262842) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.19E-02; Z-score: 2.51E-01 | ||
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in panic disorder | [ 6 ] | |||
Location |
Body (cg08122172) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.24E-03; Z-score: -4.12E-01 | ||
Methylation in Case |
5.18E+00 (Median) | Methylation in Control | 5.30E+00 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A3 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg06262842) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 8.59E-04; Z-score: -6.49E-01 | ||
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Uterine carcinosarcoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC39A3 in uterine carcinosarcoma than that in healthy individual | ||||
Studied Phenotype |
Uterine carcinosarcoma [ICD-11:2B5F] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.011645668; Fold-change: -0.439033128; Z-score: -1.400052044 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1 directly targets SLC39A3 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-124 directly targets SLC39A3 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.