Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0347 Transporter Info | ||||
Gene Name | SLC39A6 | ||||
Transporter Name | Zinc transporter ZIP6 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
5'UTR (cg26382075) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.81E+00 | Statistic Test | p-value: 6.19E-13; Z-score: 1.86E+00 | ||
Methylation in Case |
4.69E-02 (Median) | Methylation in Control | 2.59E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
Location |
3'UTR (cg23561148) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 9.57E-10; Z-score: 1.69E+00 | ||
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in bladder cancer | [ 3 ] | |||
Location |
3'UTR (cg23561148) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.73E+00 | Statistic Test | p-value: 2.49E-11; Z-score: -1.06E+01 | ||
Methylation in Case |
4.58E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in breast cancer | [ 4 ] | |||
Location |
3'UTR (cg23561148) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.61E-06; Z-score: -6.97E-01 | ||
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in colorectal cancer | [ 5 ] | |||
Location |
3'UTR (cg23561148) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 9.94E-05; Z-score: 1.32E+00 | ||
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC39A6 in panic disorder | [ 6 ] | |||
Location |
3'UTR (cg23561148) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -7.42E-01 | Statistic Test | p-value: 9.19E-03; Z-score: -3.77E-01 | ||
Methylation in Case |
-4.80E-01 (Median) | Methylation in Control | -3.57E-01 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC39A6 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.01E-25; Fold-change: -0.539483568; Z-score: -10.26774143 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC39A6 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.14E-32; Fold-change: -0.30182044; Z-score: -7.184616506 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC39A6 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.003753692; Fold-change: -0.420622655; Z-score: -39.62469515 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-101 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-101 | miRNA Mature ID | miR-101-3p | ||
miRNA Sequence |
UACAGUACUGUGAUAACUGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-126 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-135a directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-135a | miRNA Mature ID | miR-135a-5p | ||
miRNA Sequence |
UAUGGCUUUUUAUUCCUAUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-135b directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-135b | miRNA Mature ID | miR-135b-5p | ||
miRNA Sequence |
UAUGGCUUUUCAUUCCUAUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-139 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-139 | miRNA Mature ID | miR-139-5p | ||
miRNA Sequence |
UCUACAGUGCACGUGUCUCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-144 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-144 | miRNA Mature ID | miR-144-3p | ||
miRNA Sequence |
UACAGUAUAGAUGAUGUACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-26b directly targets SLC39A6 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 8 |
miR-3163 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3163 | miRNA Mature ID | miR-3163 | ||
miRNA Sequence |
UAUAAAAUGAGGGCAGUAAGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-32 directly targets SLC39A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-323a directly targets SLC39A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-323a | miRNA Mature ID | miR-323a-5p | ||
miRNA Sequence |
AGGUGGUCCGUGGCGCGUUCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 11 |
miR-410 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-410 | miRNA Mature ID | miR-410-3p | ||
miRNA Sequence |
AAUAUAACACAGAUGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-539 directly targets SLC39A6 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-539 | miRNA Mature ID | miR-539-5p | ||
miRNA Sequence |
GGAGAAAUUAUCCUUGGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 13 |
miR-548v directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548v | miRNA Mature ID | miR-548v | ||
miRNA Sequence |
AGCUACAGUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-7849 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7849 | miRNA Mature ID | miR-7849-3p | ||
miRNA Sequence |
GACAAUUGUUGAUCUUGGGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-889 directly targets SLC39A6 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-889 | miRNA Mature ID | miR-889-5p | ||
miRNA Sequence |
AAUGGCUGUCCGUAGUAUGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-92a directly targets SLC39A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-92b directly targets SLC39A6 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.