Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0349 Transporter Info
Gene Name SLC39A8
Transporter Name Zinc transporter ZIP8
Gene ID
64116
UniProt ID
Q9C0K1
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in bladder cancer [ 1 ]

Location

 TSS1500 (cg04660577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.62E+00 Statistic Test p-value: 2.28E-10; Z-score: -1.67E+01

Methylation in Case

 4.47E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A8 in bladder cancer [ 1 ]

Location

 Body (cg14579898)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.81E+00 Statistic Test p-value: 6.07E-10; Z-score: -1.34E+01

Methylation in Case

 3.35E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in hepatocellular carcinoma [ 2 ]

Location

 TSS1500 (cg04660577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.50E-05; Z-score: -5.89E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A8 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg14579898)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 7.71E-08; Z-score: -2.25E+00

Methylation in Case

 2.63E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in lung adenocarcinoma [ 3 ]

Location

 TSS1500 (cg04660577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.38E-04; Z-score: 1.84E+00

Methylation in Case

 8.02E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in pancretic ductal adenocarcinoma [ 4 ]

Location

 TSS200 (cg23474268)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.72E-02; Z-score: -2.71E-01

Methylation in Case

 1.11E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A8 in pancretic ductal adenocarcinoma [ 4 ]

Location

 Body (cg24924505)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 2.74E-08; Z-score: -1.96E+00

Methylation in Case

 4.11E-01 (Median) Methylation in Control 5.98E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg14579898)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.79E-02; Z-score: -3.80E-01

Methylation in Case

 7.11E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A8 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 3'UTR (cg26184765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.44E-09; Z-score: -2.17E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in breast cancer [ 6 ]

Location

 Body (cg14579898)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.32E-05; Z-score: -1.22E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A8 in systemic lupus erythematosus [ 7 ]

Location

 3'UTR (cg26184765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 1.56E-02; Z-score: 2.02E-03

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1260b directly targets SLC39A8 [ 8 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

 AUCCCACCACUGCCACCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-192 directly targets SLC39A8 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-215 directly targets SLC39A8 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-30c-1 directly targets SLC39A8 [ 8 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-30c-1 miRNA Mature ID miR-30c-1-3p

miRNA Sequence

 CUGGGAGAGGGUUGUUUACUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-331 directly targets SLC39A8 [ 8 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-331 miRNA Mature ID miR-331-3p

miRNA Sequence

 GCCCCUGGGCCUAUCCUAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
6 Genome-wide Scan for Methylation Profiles in Breast Cancer
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.