Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0350 Transporter Info
Gene Name SLC39A9
Transporter Name Zinc transporter ZIP9
Gene ID
55334
UniProt ID
Q9NUM3
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg08828036)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 2.42E-07; Z-score: 1.83E+00

Methylation in Case

 6.79E-01 (Median) Methylation in Control 4.78E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg06955716)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.15E-03; Z-score: 8.43E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.08E-02; Z-score: 2.35E-01

Methylation in Case

 9.22E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 3'UTR (cg10776397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 3.35E-12; Z-score: 2.17E+00

Methylation in Case

 8.65E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in bladder cancer [ 3 ]

Location

 Body (cg06955716)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 3.82E-08; Z-score: -1.45E+01

Methylation in Case

 6.12E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in breast cancer [ 4 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 5.95E-05; Z-score: -1.11E+00

Methylation in Case

 8.40E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in colorectal cancer [ 5 ]

Location

 Body (cg06955716)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.61E-05; Z-score: -8.03E-01

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A9 in colorectal cancer [ 5 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.63E-02; Z-score: -4.93E-01

Methylation in Case

 9.25E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in depression [ 6 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.87E-02; Z-score: -4.66E-01

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg06955716)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.29E-08; Z-score: -1.91E+00

Methylation in Case

 8.15E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A9 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.35E-04; Z-score: -6.70E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in HIV infection [ 8 ]

Location

 Body (cg06955716)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.62E-06; Z-score: -1.70E+00

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC39A9 in HIV infection [ 8 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.53E-02; Z-score: -6.07E-01

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC39A9 in HIV infection [ 8 ]

Location

 3'UTR (cg10776397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.89E-02; Z-score: -4.44E-01

Methylation in Case

 9.47E-01 (Median) Methylation in Control 9.58E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC39A9 in papillary thyroid cancer [ 9 ]

Location

 Body (cg13990980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 6.77E-04; Z-score: -5.92E-01

Methylation in Case

 9.15E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          66 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1226 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

 UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1323 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1323 miRNA Mature ID miR-1323

miRNA Sequence

 UCAAAACUGAGGGGCAUUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-133a directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-133a miRNA Mature ID miR-133a-5p

miRNA Sequence

 AGCUGGUAAAAUGGAACCAAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-142 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

 UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-151a directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-151a miRNA Mature ID miR-151a-5p

miRNA Sequence

 UCGAGGAGCUCACAGUCUAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-151b directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-151b miRNA Mature ID miR-151b

miRNA Sequence

 UCGAGGAGCUCACAGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-15a directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-15b directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-16 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-192 directly targets SLC39A9 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

 CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-192 directly targets SLC39A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-195 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-19a directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-5p

miRNA Sequence

 AGUUUUGCAUAGUUGCACUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-19b-1 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b-1 miRNA Mature ID miR-19b-1-5p

miRNA Sequence

 AGUUUUGCAGGUUUGCAUCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-19b-2 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b-2 miRNA Mature ID miR-19b-2-5p

miRNA Sequence

 AGUUUUGCAGGUUUGCAUUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-203a directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-203a miRNA Mature ID miR-203a-3p

miRNA Sequence

 GUGAAAUGUUUAGGACCACUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-204 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-2052 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2052 miRNA Mature ID miR-2052

miRNA Sequence

 UGUUUUGAUAACAGUAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-211 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

 UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-215 directly targets SLC39A9 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-218 directly targets SLC39A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-218-1 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-218-1 miRNA Mature ID miR-218-1-3p

miRNA Sequence

 AUGGUUCCGUCAAGCACCAUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-224 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-224 miRNA Mature ID miR-224-3p

miRNA Sequence

 AAAAUGGUGCCCUAGUGACUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-3117 directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3117 miRNA Mature ID miR-3117-5p

miRNA Sequence

 AGACACUAUACGAGUCAUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-3150b directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

 UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-33a directly targets SLC39A9 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

 CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-3613 directly targets SLC39A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

 ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-3679 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3679 miRNA Mature ID miR-3679-3p

miRNA Sequence

 CUUCCCCCCAGUAAUCUUCAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-371b directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

 ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-373 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

 ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-3929 directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

 GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-3975 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3975 miRNA Mature ID miR-3975

miRNA Sequence

 UGAGGCUAAUGCACUACUUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-424 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

 CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-4280 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4280 miRNA Mature ID miR-4280

miRNA Sequence

 GAGUGUAGUUCUGAGCAGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-4307 directly targets SLC39A9 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

 AAUGUUUUUUCCUGUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-432 directly targets SLC39A9 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-432 miRNA Mature ID miR-432-3p

miRNA Sequence

 CUGGAUGGCUCCUCCAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 37

 miR-4474 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4474 miRNA Mature ID miR-4474-3p

miRNA Sequence

 UUGUGGCUGGUCAUGAGGCUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-4478 directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

 GAGGCUGAGCUGAGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-4490 directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4490 miRNA Mature ID miR-4490

miRNA Sequence

 UCUGGUAAGAGAUUUGGGCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-4530 directly targets SLC39A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4530 miRNA Mature ID miR-4530

miRNA Sequence

 CCCAGCAGGACGGGAGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-4684 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

 CUCUCUACUGACUUGCAACAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-4691 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4691 miRNA Mature ID miR-4691-3p

miRNA Sequence

 CCAGCCACGGACUGAGAGUGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-4768 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

 AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-4784 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-485 directly targets SLC39A9 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 46

 miR-497 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

 CAGCAGCACACUGUGGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-510 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

 AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-5190 directly targets SLC39A9 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5190 miRNA Mature ID miR-5190

miRNA Sequence

 CCAGUGACUGAGCUGGAGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-520f directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520f miRNA Mature ID miR-520f-5p

miRNA Sequence

 CCUCUAAAGGGAAGCGCUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-522 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-522 miRNA Mature ID miR-522-3p

miRNA Sequence

 AAAAUGGUUCCCUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-545 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-545 miRNA Mature ID miR-545-3p

miRNA Sequence

 UCAGCAAACAUUUAUUGUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-548o directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548o miRNA Mature ID miR-548o-3p

miRNA Sequence

 CCAAAACUGCAGUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-5584 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5584 miRNA Mature ID miR-5584-5p

miRNA Sequence

 CAGGGAAAUGGGAAGAACUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-616 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

 ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-634 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-634 miRNA Mature ID miR-634

miRNA Sequence

 AACCAGCACCCCAACUUUGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-659 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-659 miRNA Mature ID miR-659-3p

miRNA Sequence

 CUUGGUUCAGGGAGGGUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-6792 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6792 miRNA Mature ID miR-6792-5p

miRNA Sequence

 GUAAGCAGGGGCUCUGGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-6832 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-3p

miRNA Sequence

 ACCCUUUUUCUCUUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-6833 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

 UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 60

 miR-6838 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

 AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-6873 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6873 miRNA Mature ID miR-6873-5p

miRNA Sequence

 CAGAGGGAAUACAGAGGGCAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 62

 miR-7108 directly targets SLC39A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7108 miRNA Mature ID miR-7108-5p

miRNA Sequence

 GUGUGGCCGGCAGGCGGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 63

 miR-8066 directly targets SLC39A9 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8066 miRNA Mature ID miR-8066

miRNA Sequence

 CAAUGUGAUCUUUUGGAUGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-8080 directly targets SLC39A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8080 miRNA Mature ID miR-8080

miRNA Sequence

 GAAGGACACUGGUGUCAACGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 65

 miR-888 directly targets SLC39A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

 UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-891b directly targets SLC39A9 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-891b miRNA Mature ID miR-891b

miRNA Sequence

 UGCAACUUACCUGAGUCAUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
11 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
14 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
15 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
16 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
17 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
18 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.