Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0351 Transporter Info
Gene Name SLC3A1
Transporter Name Neutral and basic amino acid transport protein rBAT
Gene ID
6519
UniProt ID
Q07837
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg14411266)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.33E+00 Statistic Test p-value: 1.12E-09; Z-score: 5.58E+00

Methylation in Case

 1.59E-01 (Median) Methylation in Control 4.76E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 1stExon (cg03217954)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.60E-02; Z-score: 6.56E-02

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg00990690)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.90E+00 Statistic Test p-value: 8.61E-22; Z-score: -4.37E+00

Methylation in Case

 3.46E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg11634297)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.56E+00 Statistic Test p-value: 2.18E-18; Z-score: -3.95E+00

Methylation in Case

 4.37E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg02770054)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.25E+00 Statistic Test p-value: 9.98E-15; Z-score: 4.25E+00

Methylation in Case

 4.87E-01 (Median) Methylation in Control 2.17E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg12033248)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 2.77E-14; Z-score: -5.66E+00

Methylation in Case

 5.78E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 5.28E-08; Z-score: -1.12E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 1.59E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC3A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg09959718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.75E-03; Z-score: -2.51E-01

Methylation in Case

 7.83E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in prostate cancer [ 2 ]

Location

 5'UTR (cg09546172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.68E+00 Statistic Test p-value: 1.71E-02; Z-score: -1.84E+00

Methylation in Case

 1.28E-01 (Median) Methylation in Control 2.15E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in prostate cancer [ 2 ]

Location

 Body (cg15746253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.09E-02; Z-score: -7.59E+00

Methylation in Case

 6.69E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in prostate cancer [ 2 ]

Location

 Body (cg08518839)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.57E-02; Z-score: 1.97E+00

Methylation in Case

 9.72E-01 (Median) Methylation in Control 9.60E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg03902905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.44E-04; Z-score: -2.75E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg09067747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.42E-03; Z-score: -2.12E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 8.73E-05; Z-score: -6.52E+00

Methylation in Case

 6.43E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 Body (cg21843262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.48E+00 Statistic Test p-value: 1.45E-14; Z-score: -4.96E+01

Methylation in Case

 3.92E-01 (Median) Methylation in Control 9.74E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 Body (cg09860050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.16E+00 Statistic Test p-value: 2.65E-14; Z-score: -1.98E+01

Methylation in Case

 3.30E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 Body (cg24724513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.00E+00 Statistic Test p-value: 7.93E-14; Z-score: -1.40E+01

Methylation in Case

 2.27E-01 (Median) Methylation in Control 6.81E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 2.73E-05; Z-score: -3.94E+00

Methylation in Case

 9.32E-02 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC3A1 in bladder cancer [ 3 ]

Location

 Body (cg09959718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 6.10E-05; Z-score: -6.23E+00

Methylation in Case

 6.69E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 TSS1500 (cg09067747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.79E-02; Z-score: -5.05E-01

Methylation in Case

 5.40E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 7.74E-05; Z-score: -1.23E+00

Methylation in Case

 6.98E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 1stExon (cg03217954)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.91E-03; Z-score: -7.16E-01

Methylation in Case

 8.46E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 Body (cg09860050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 8.91E-14; Z-score: -3.92E+00

Methylation in Case

 6.12E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 Body (cg21843262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 7.39E-12; Z-score: -5.30E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 9.65E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 Body (cg24724513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.78E-08; Z-score: -1.44E+00

Methylation in Case

 5.14E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 2.04E-04; Z-score: 1.56E+00

Methylation in Case

 1.69E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC3A1 in breast cancer [ 4 ]

Location

 Body (cg09959718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.75E-03; Z-score: -2.39E-01

Methylation in Case

 7.88E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg09067747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.92E-09; Z-score: -2.00E+00

Methylation in Case

 5.89E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg03902905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.05E-07; Z-score: -1.50E+00

Methylation in Case

 6.93E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in colorectal cancer [ 5 ]

Location

 Body (cg09959718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.12E-02; Z-score: -2.73E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in colorectal cancer [ 5 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 4.97E-02; Z-score: -4.71E-01

Methylation in Case

 2.05E-01 (Median) Methylation in Control 2.34E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg03902905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.35E-02; Z-score: -1.29E+00

Methylation in Case

 7.41E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in lung adenocarcinoma [ 6 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.83E-02; Z-score: -1.24E+00

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in lung adenocarcinoma [ 6 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 1.81E-03; Z-score: 2.92E+00

Methylation in Case

 2.42E-01 (Median) Methylation in Control 1.75E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in lung adenocarcinoma [ 6 ]

Location

 Body (cg24724513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.88E-03; Z-score: -2.31E+00

Methylation in Case

 6.46E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in lung adenocarcinoma [ 6 ]

Location

 Body (cg21843262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.16E-02; Z-score: -8.75E+00

Methylation in Case

 9.23E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg00648005)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.84E-04; Z-score: -1.04E+00

Methylation in Case

 5.39E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg04713352)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 5.93E-04; Z-score: -7.81E-01

Methylation in Case

 5.82E-01 (Median) Methylation in Control 6.29E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS200 (cg22113930)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 7.47E+00 Statistic Test p-value: 4.10E-07; Z-score: 2.05E+00

Methylation in Case

 4.07E-01 (Median) Methylation in Control 5.45E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 3.64E-06; Z-score: 1.06E+00

Methylation in Case

 9.62E-02 (Median) Methylation in Control 7.81E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg04264781)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 5.32E-03; Z-score: 7.80E-01

Methylation in Case

 9.10E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg03902905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.11E-03; Z-score: -2.60E-01

Methylation in Case

 7.20E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 1.58E-27; Z-score: -6.58E+00

Methylation in Case

 5.64E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 1stExon (cg03217954)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 1.05E-25; Z-score: -4.50E+00

Methylation in Case

 5.86E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg09860050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.22E-02; Z-score: -3.88E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg09959718)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.27E-02; Z-score: 4.54E-01

Methylation in Case

 8.89E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.82E-02; Z-score: 7.53E-02

Methylation in Case

 1.91E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in HIV infection [ 10 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.36E-06; Z-score: -2.12E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC3A1 in HIV infection [ 10 ]

Location

 Body (cg10801607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 4.96E-07; Z-score: 2.15E+00

Methylation in Case

 2.99E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC3A1 in HIV infection [ 10 ]

Location

 Body (cg24724513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 6.27E-03; Z-score: -5.80E-01

Methylation in Case

 7.15E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC3A1 in HIV infection [ 10 ]

Location

 Body (cg21843262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.31E-03; Z-score: -9.70E-01

Methylation in Case

 9.79E-01 (Median) Methylation in Control 9.86E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC3A1 in HIV infection [ 10 ]

Location

 Body (cg09860050)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.01E-02; Z-score: -3.99E-01

Methylation in Case

 7.84E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC3A1 in papillary thyroid cancer [ 11 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.44E-02; Z-score: -3.67E-01

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-382 directly targets SLC3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-382 miRNA Mature ID miR-382-5p

miRNA Sequence

 GAAGUUGUUCGUGGUGGAUUCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-548e directly targets SLC3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548e miRNA Mature ID miR-548e-5p

miRNA Sequence

 CAAAAGCAAUCGCGGUUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.