Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0352 Transporter Info
Gene Name SLC3A2
Transporter Name Lymphocyte activation antigen 4F2
Gene ID
6520
UniProt ID
P08195
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets SLC3A2 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-1260b directly targets SLC3A2 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

 AUCCCACCACUGCCACCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-16 directly targets SLC3A2 [ 2 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 4

 miR-193b directly targets SLC3A2 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-2115 directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2115 miRNA Mature ID miR-2115-3p

miRNA Sequence

 CAUCAGAAUUCAUGGAGGCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-26b directly targets SLC3A2 [ 4 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 7

 miR-412 directly targets SLC3A2 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-412 miRNA Mature ID miR-412-3p

miRNA Sequence

 ACUUCACCUGGUCCACUAGCCGU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 miR-4311 directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4311 miRNA Mature ID miR-4311

miRNA Sequence

 GAAAGAGAGCUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-4709 directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4709 miRNA Mature ID miR-4709-5p

miRNA Sequence

 ACAACAGUGACUUGCUCUCCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-548c directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548c miRNA Mature ID miR-548c-3p

miRNA Sequence

 CAAAAAUCUCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-6844 directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6844 miRNA Mature ID miR-6844

miRNA Sequence

 UUCUUUGUUUUUAAUUCACAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-8068 directly targets SLC3A2 [ 3 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8068 miRNA Mature ID miR-8068

miRNA Sequence

 UGUUUGUUGUAAGGAUCGUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-92a directly targets SLC3A2 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

Methylation

  Glioblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC3A2 in glioblastoma than that in healthy individual

Studied Phenotype

 Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.93E-09; Fold-change: -0.203328982; Z-score: -1.330229584
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Hemangioblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC3A2 in hemangioblastoma than that in healthy individual

Studied Phenotype

 Hemangioblastoma [ICD-11:2F7C]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.66E-09; Fold-change: -0.288578473; Z-score: -2.046064481
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Uterine carcinosarcoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC3A2 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

 Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.89E-05; Fold-change: 0.333757603; Z-score: 1.947678188
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC3A2 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.49E-42; Fold-change: -0.473515129; Z-score: -7.442986446
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
4 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
5 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.