Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0354 Transporter Info
Gene Name SLC41A1
Transporter Name Magnesium transporter protein solute carrier family 41 member 1
Gene ID
254428
UniProt ID
Q8IVJ1
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 5'UTR (cg00762738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.16E-03; Z-score: 2.47E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 9.81E-03; Z-score: 8.90E-01

Methylation in Case

 3.36E-01 (Median) Methylation in Control 3.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 5'UTR (cg03046812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.20E-02; Z-score: 1.45E+00

Methylation in Case

 7.76E-02 (Median) Methylation in Control 6.72E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 5'UTR (cg01654312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.19E-02; Z-score: 1.29E+00

Methylation in Case

 9.85E-02 (Median) Methylation in Control 8.92E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 5'UTR (cg26866142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.26E-02; Z-score: 1.98E-02

Methylation in Case

 9.08E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 TSS1500 (cg13453750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.84E+00 Statistic Test p-value: 1.92E-08; Z-score: -6.41E+00

Methylation in Case

 3.74E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 TSS1500 (cg05738246)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.56E-03; Z-score: -2.11E+00

Methylation in Case

 5.25E-02 (Median) Methylation in Control 6.41E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 Body (cg14413177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 1.49E-07; Z-score: -9.99E+00

Methylation in Case

 3.79E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 Body (cg09790270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.98E+00 Statistic Test p-value: 1.72E-06; Z-score: -4.85E+00

Methylation in Case

 1.69E-01 (Median) Methylation in Control 3.35E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC41A1 in bladder cancer [ 1 ]

Location

 3'UTR (cg07551022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.64E-07; Z-score: 6.44E+00

Methylation in Case

 9.20E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 4.72E-38; Z-score: 5.39E+00

Methylation in Case

 6.42E-01 (Median) Methylation in Control 3.81E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 5'UTR (cg00762738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.81E-09; Z-score: 1.20E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 5'UTR (cg03046812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.75E+00 Statistic Test p-value: 1.53E-08; Z-score: 1.98E+00

Methylation in Case

 1.57E-01 (Median) Methylation in Control 8.97E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 5'UTR (cg01654312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 4.29E-06; Z-score: 4.36E-01

Methylation in Case

 1.18E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 TSS1500 (cg13453750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.00E-02; Z-score: 1.33E+00

Methylation in Case

 7.87E-01 (Median) Methylation in Control 7.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC41A1 in breast cancer [ 2 ]

Location

 Body (cg09790270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 4.36E-02; Z-score: 7.62E-01

Methylation in Case

 3.37E-01 (Median) Methylation in Control 2.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.74E+00 Statistic Test p-value: 1.82E-08; Z-score: 2.26E+00

Methylation in Case

 4.49E-01 (Median) Methylation in Control 2.59E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg00762738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.54E-03; Z-score: 2.85E+00

Methylation in Case

 9.14E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg03046812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.63E+00 Statistic Test p-value: 9.92E-03; Z-score: 4.72E-01

Methylation in Case

 4.33E-02 (Median) Methylation in Control 2.66E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg00097626)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 9.21E-03; Z-score: 1.84E-01

Methylation in Case

 1.30E-02 (Median) Methylation in Control 1.28E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg16315748)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.32E-02; Z-score: 2.84E-01

Methylation in Case

 1.40E-02 (Median) Methylation in Control 1.35E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in colorectal cancer [ 4 ]

Location

 5'UTR (cg01654312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.10E-02; Z-score: 1.39E-01

Methylation in Case

 1.40E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in colorectal cancer [ 4 ]

Location

 3'UTR (cg07551022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 5.76E-03; Z-score: 7.26E-01

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg01654312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 2.27E-04; Z-score: 1.43E+00

Methylation in Case

 3.33E-01 (Median) Methylation in Control 2.14E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg03046812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.57E-03; Z-score: 9.46E-01

Methylation in Case

 3.33E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg26866142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.16E-03; Z-score: -1.54E-01

Methylation in Case

 8.86E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.88E-02; Z-score: 8.06E-01

Methylation in Case

 5.53E-01 (Median) Methylation in Control 4.90E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg00664682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 5.18E-03; Z-score: 2.13E-01

Methylation in Case

 5.37E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg15835056)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 7.67E-03; Z-score: 1.12E-01

Methylation in Case

 5.51E-02 (Median) Methylation in Control 5.40E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg05738246)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.29E-02; Z-score: 2.33E-01

Methylation in Case

 5.32E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg13453750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.19E-02; Z-score: -8.44E-02

Methylation in Case

 7.92E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg00097626)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 8.62E-04; Z-score: 4.44E-03

Methylation in Case

 2.02E-02 (Median) Methylation in Control 2.01E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg16315748)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.89E-03; Z-score: -3.03E-02

Methylation in Case

 1.73E-02 (Median) Methylation in Control 1.76E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg25022560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.00E-03; Z-score: 9.29E-04

Methylation in Case

 2.17E-02 (Median) Methylation in Control 2.17E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg08895013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.13E+00 Statistic Test p-value: 4.20E-16; Z-score: -4.14E+00

Methylation in Case

 2.46E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg04933168)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 3.05E-12; Z-score: -3.58E+00

Methylation in Case

 4.63E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC41A1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg21307155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 5.98E-10; Z-score: -1.75E+00

Methylation in Case

 5.85E-01 (Median) Methylation in Control 6.80E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in lung adenocarcinoma [ 6 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 7.59E-03; Z-score: 2.71E+00

Methylation in Case

 5.83E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in lung adenocarcinoma [ 6 ]

Location

 5'UTR (cg03046812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.48E-02; Z-score: 1.23E+00

Methylation in Case

 1.41E-01 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg13453750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 6.24E-04; Z-score: 1.78E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in lung adenocarcinoma [ 6 ]

Location

 3'UTR (cg07551022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.50E-02; Z-score: 1.30E+00

Methylation in Case

 9.20E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg00762738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.37E-07; Z-score: 1.65E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg10717869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 5.60E-03; Z-score: 7.60E-01

Methylation in Case

 2.19E-01 (Median) Methylation in Control 1.58E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg05738246)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.80E-04; Z-score: -4.06E-01

Methylation in Case

 4.05E-02 (Median) Methylation in Control 4.46E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg13453750)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.92E-04; Z-score: 1.27E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg00664682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.25E-03; Z-score: -5.27E-01

Methylation in Case

 4.54E-02 (Median) Methylation in Control 4.94E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 Body (cg09790270)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.38E+00 Statistic Test p-value: 1.68E-22; Z-score: -2.50E+00

Methylation in Case

 1.22E-01 (Median) Methylation in Control 2.90E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC41A1 in papillary thyroid cancer [ 7 ]

Location

 Body (cg14413177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.84E-02; Z-score: -5.46E-01

Methylation in Case

 5.84E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in colon adenocarcinoma [ 8 ]

Location

 TSS1500 (cg07424912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 4.20E-04; Z-score: -2.15E+00

Methylation in Case

 5.06E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in colon adenocarcinoma [ 8 ]

Location

 TSS1500 (cg05782445)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.52E-03; Z-score: 1.49E+00

Methylation in Case

 4.04E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in colon adenocarcinoma [ 8 ]

Location

 Body (cg12778938)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 2.26E-07; Z-score: -5.29E+00

Methylation in Case

 4.74E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in colon adenocarcinoma [ 8 ]

Location

 Body (cg02557110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.39E-03; Z-score: 1.26E+00

Methylation in Case

 8.22E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02363950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.82E+00 Statistic Test p-value: 1.35E-10; Z-score: -2.01E+00

Methylation in Case

 2.54E-01 (Median) Methylation in Control 4.64E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg04101194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.04E-03; Z-score: 3.79E-01

Methylation in Case

 1.38E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02075570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.08E-02; Z-score: -3.31E-01

Methylation in Case

 7.95E-02 (Median) Methylation in Control 8.51E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg13265003)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.06E-02; Z-score: 3.53E-02

Methylation in Case

 7.22E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A1 in prostate cancer [ 10 ]

Location

 TSS200 (cg27288424)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.84E+00 Statistic Test p-value: 3.60E-02; Z-score: -1.76E+00

Methylation in Case

 7.86E-02 (Median) Methylation in Control 2.23E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A1 in prostate cancer [ 10 ]

Location

 Body (cg05825700)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.01E-03; Z-score: 5.20E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A1 in prostate cancer [ 10 ]

Location

 Body (cg11828251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.68E-03; Z-score: 6.28E+00

Methylation in Case

 9.09E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A1 in prostate cancer [ 10 ]

Location

 Body (cg16676775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 4.21E-02; Z-score: -2.16E+00

Methylation in Case

 5.63E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1250 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1250 miRNA Mature ID miR-1250-3p

miRNA Sequence

 ACAUUUUCCAGCCCAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-153 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-153 miRNA Mature ID miR-153-5p

miRNA Sequence

 UCAUUUUUGUGAUGUUGCAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-205 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-205 miRNA Mature ID miR-205-5p

miRNA Sequence

 UCCUUCAUUCCACCGGAGUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-224 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-224 miRNA Mature ID miR-224-5p

miRNA Sequence

 UCAAGUCACUAGUGGUUCCGUUUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-3124 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3124 miRNA Mature ID miR-3124-3p

miRNA Sequence

 ACUUUCCUCACUCCCGUGAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-4446 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4446 miRNA Mature ID miR-4446-5p

miRNA Sequence

 AUUUCCCUGCCAUUCCCUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4755 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

 UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-5006 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

 UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-5696 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5696 miRNA Mature ID miR-5696

miRNA Sequence

 CUCAUUUAAGUAGUCUGAUGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-579 directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-579 miRNA Mature ID miR-579-3p

miRNA Sequence

 UUCAUUUGGUAUAAACCGCGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-664b directly targets SLC41A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-664b miRNA Mature ID miR-664b-3p

miRNA Sequence

 UUCAUUUGCCUCCCAGCCUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.