Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0355 Transporter Info | ||||
Gene Name | SLC41A2 | ||||
Transporter Name | Magnesium transporter protein solute carrier family 41 member 2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
5'UTR (cg09094674) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 3.53E-02; Z-score: -1.47E+00 | ||
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 2.68E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg03219657) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 2.18E-09; Z-score: -1.52E+00 | ||
Methylation in Case |
3.19E-01 (Median) | Methylation in Control | 4.79E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg07260532) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.33E-02; Z-score: -8.25E-01 | ||
Methylation in Case |
1.83E-01 (Median) | Methylation in Control | 2.37E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
1stExon (cg04098339) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 8.86E-15; Z-score: 2.44E+00 | ||
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg16061354) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.42E-04; Z-score: -6.71E-01 | ||
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 6 |
Methylation of SLC41A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
3'UTR (cg22599115) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 6.11E-07; Z-score: 1.66E+00 | ||
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 6.28E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
TSS1500 (cg23855818) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 4.77E-06; Z-score: -5.15E+00 | ||
Methylation in Case |
6.20E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
TSS1500 (cg20495009) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.26E-02; Z-score: -1.07E-01 | ||
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
TSS200 (cg25107282) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.22E-03; Z-score: -2.24E+00 | ||
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
Body (cg02329494) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -2.72E+00 | Statistic Test | p-value: 3.46E-11; Z-score: -1.15E+01 | ||
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
Body (cg22784260) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -2.43E+00 | Statistic Test | p-value: 9.42E-10; Z-score: -9.46E+00 | ||
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 6.25E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 6 |
Methylation of SLC41A2 in bladder cancer | [ 2 ] | |||
Location |
Body (cg02071798) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.71E-03; Z-score: -2.66E+00 | ||
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
TSS1500 (cg20495009) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 8.95E-05; Z-score: -9.47E-01 | ||
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
TSS1500 (cg23855818) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.18E-02; Z-score: -2.13E-01 | ||
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
TSS200 (cg25107282) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 6.77E-07; Z-score: 1.35E+00 | ||
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
Body (cg02329494) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.83E-09; Z-score: -2.11E+00 | ||
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
Body (cg02071798) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.05E-05; Z-score: -1.22E+00 | ||
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 6 |
Methylation of SLC41A2 in breast cancer | [ 3 ] | |||
Location |
Body (cg22784260) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.57E-03; Z-score: -1.00E-01 | ||
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in hepatocellular carcinoma | [ 4 ] | |||
Location |
TSS1500 (cg23855818) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 7.34E-06; Z-score: -1.09E+00 | ||
Methylation in Case |
4.86E-01 (Median) | Methylation in Control | 5.95E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in hepatocellular carcinoma | [ 4 ] | |||
Location |
TSS1500 (cg20495009) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.10E-02; Z-score: -2.56E-01 | ||
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC41A2 in hepatocellular carcinoma | [ 4 ] | |||
Location |
Body (cg17836790) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 5.08E-11; Z-score: -5.91E+00 | ||
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC41A2 in hepatocellular carcinoma | [ 4 ] | |||
Location |
Body (cg02329494) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.12E-04; Z-score: -4.65E-01 | ||
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in lung adenocarcinoma | [ 5 ] | |||
Location |
TSS1500 (cg23855818) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.40E-02; Z-score: 9.24E-01 | ||
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in lung adenocarcinoma | [ 5 ] | |||
Location |
Body (cg02071798) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.41E-04; Z-score: -3.41E+00 | ||
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 7.75E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in panic disorder | [ 6 ] | |||
Location |
TSS200 (cg25107282) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -7.96E-01 | Statistic Test | p-value: 1.35E-02; Z-score: -4.61E-01 | ||
Methylation in Case |
-6.00E-01 (Median) | Methylation in Control | -4.78E-01 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in panic disorder | [ 6 ] | |||
Location |
Body (cg02329494) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.12E-03; Z-score: -3.58E-01 | ||
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in papillary thyroid cancer | [ 7 ] | |||
Location |
TSS200 (cg25107282) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.65E-02; Z-score: -5.35E-01 | ||
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg22784260) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 6.81E-12; Z-score: -2.22E+00 | ||
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC41A2 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg02329494) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 6.75E-03; Z-score: 5.16E-01 | ||
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in colorectal cancer | [ 8 ] | |||
Location |
Body (cg02071798) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 4.24E-14; Z-score: -2.83E+00 | ||
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC41A2 in colorectal cancer | [ 8 ] | |||
Location |
Body (cg22784260) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.38E-02; Z-score: -3.78E-01 | ||
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC41A2 in prostate cancer | [ 9 ] | |||
Location |
Body (cg03731131) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 3.63E-02; Z-score: 2.01E+00 | ||
Methylation in Case |
7.13E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC41A2 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.46E-15; Fold-change: -0.25749522; Z-score: -5.787330013 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC41A2 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.49E-17; Fold-change: -0.243857801; Z-score: -5.47748559 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
33 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-126 directly targets SLC41A2 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 2 |
miR-1827 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1827 | miRNA Mature ID | miR-1827 | ||
miRNA Sequence |
UGAGGCAGUAGAUUGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-22 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-22 | miRNA Mature ID | miR-22-5p | ||
miRNA Sequence |
AGUUCUUCAGUGGCAAGCUUUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-3184 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3184 | miRNA Mature ID | miR-3184-3p | ||
miRNA Sequence |
AAAGUCUCGCUCUCUGCCCCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-342 directly targets SLC41A2 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-342 | miRNA Mature ID | miR-342-3p | ||
miRNA Sequence |
UCUCACACAGAAAUCGCACCCGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-34b directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-34b | miRNA Mature ID | miR-34b-3p | ||
miRNA Sequence |
CAAUCACUAACUCCACUGCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-3614 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-5p | ||
miRNA Sequence |
CCACUUGGAUCUGAAGGCUGCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-3689d directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-377 directly targets SLC41A2 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-377 | miRNA Mature ID | miR-377-3p | ||
miRNA Sequence |
AUCACACAAAGGCAACUUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-3929 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3929 | miRNA Mature ID | miR-3929 | ||
miRNA Sequence |
GAGGCUGAUGUGAGUAGACCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-4478 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4478 | miRNA Mature ID | miR-4478 | ||
miRNA Sequence |
GAGGCUGAGCUGAGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-4649 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4649 | miRNA Mature ID | miR-4649-3p | ||
miRNA Sequence |
UCUGAGGCCUGCCUCUCCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4722 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4768 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4768 | miRNA Mature ID | miR-4768-3p | ||
miRNA Sequence |
CCAGGAGAUCCAGAGAGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-485 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-6134 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6134 | miRNA Mature ID | miR-6134 | ||
miRNA Sequence |
UGAGGUGGUAGGAUGUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-6500 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6500 | miRNA Mature ID | miR-6500-3p | ||
miRNA Sequence |
ACACUUGUUGGGAUGACCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-665 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-6746 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6746 | miRNA Mature ID | miR-6746-5p | ||
miRNA Sequence |
CCGGGAGAAGGAGGUGGCCUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-6771 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6771 | miRNA Mature ID | miR-6771-5p | ||
miRNA Sequence |
CUCGGGAGGGCAUGGGCCAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-6808 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6808 | miRNA Mature ID | miR-6808-5p | ||
miRNA Sequence |
CAGGCAGGGAGGUGGGACCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-6817 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6817 | miRNA Mature ID | miR-6817-3p | ||
miRNA Sequence |
UCUCUCUGACUCCAUGGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-6851 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-6873 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6873 | miRNA Mature ID | miR-6873-3p | ||
miRNA Sequence |
UUCUCUCUGUCUUUCUCUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-6880 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6880 | miRNA Mature ID | miR-6880-5p | ||
miRNA Sequence |
UGGUGGAGGAAGAGGGCAGCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-6884 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6884 | miRNA Mature ID | miR-6884-5p | ||
miRNA Sequence |
AGAGGCUGAGAAGGUGAUGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-6893 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6893 | miRNA Mature ID | miR-6893-5p | ||
miRNA Sequence |
CAGGCAGGUGUAGGGUGGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-6895 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6895 | miRNA Mature ID | miR-6895-3p | ||
miRNA Sequence |
UGUCUCUCGCCCUUGGCCUUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-7110 directly targets SLC41A2 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7110 | miRNA Mature ID | miR-7110-3p | ||
miRNA Sequence |
UCUCUCUCCCACUUCCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-7160 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-5p | ||
miRNA Sequence |
UGCUGAGGUCCGGGCUGUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-7847 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7847 | miRNA Mature ID | miR-7847-3p | ||
miRNA Sequence |
CGUGGAGGACGAGGAGGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-8485 directly targets SLC41A2 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
miRNA Sequence |
CACACACACACACACACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 33 |
miR-940 directly targets SLC41A2 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-940 | miRNA Mature ID | miR-940 | ||
miRNA Sequence |
AAGGCAGGGCCCCCGCUCCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.