Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0356 Transporter Info
Gene Name SLC41A3
Transporter Name Magnesium transporter protein solute carrier family 41 member 3
Gene ID
54946
UniProt ID
Q96GZ6
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg25742458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.20E-03; Z-score: -2.94E-01

Methylation in Case

 9.14E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg24141378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.88E-02; Z-score: 4.09E-01

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg18949702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.04E-02; Z-score: 2.64E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg08509840)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 1.44E-08; Z-score: 7.16E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 4.83E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg25365006)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.17E-02; Z-score: -2.15E+00

Methylation in Case

 7.05E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg14598764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.75E-04; Z-score: 4.65E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg24663845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 5.06E-04; Z-score: 3.03E+00

Methylation in Case

 7.36E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in breast cancer [ 3 ]

Location

 TSS1500 (cg08509840)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 9.76E-19; Z-score: 3.28E+00

Methylation in Case

 6.08E-01 (Median) Methylation in Control 4.58E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in breast cancer [ 3 ]

Location

 TSS200 (cg20177385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 3.39E-10; Z-score: -2.05E+00

Methylation in Case

 5.50E-01 (Median) Methylation in Control 6.65E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in breast cancer [ 3 ]

Location

 TSS200 (cg14598764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.06E-02; Z-score: -6.59E-01

Methylation in Case

 7.23E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A3 in breast cancer [ 3 ]

Location

 TSS200 (cg24663845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.05E-02; Z-score: 4.17E-01

Methylation in Case

 7.30E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg23085666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.08E-04; Z-score: -8.44E-01

Methylation in Case

 9.52E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg08509840)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.95E-02; Z-score: 4.65E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in colorectal cancer [ 4 ]

Location

 TSS200 (cg20177385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.38E-10; Z-score: -2.16E+00

Methylation in Case

 7.12E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A3 in colorectal cancer [ 4 ]

Location

 TSS200 (cg14598764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.22E-03; Z-score: -1.47E+00

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg04539957)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 5.54E-17; Z-score: 2.13E+00

Methylation in Case

 7.33E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg08509840)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 7.03E-04; Z-score: -6.27E-01

Methylation in Case

 7.09E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg23085666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.13E-03; Z-score: -3.32E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg25365006)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.88E-02; Z-score: -2.87E-01

Methylation in Case

 7.72E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg02318629)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.21E+00 Statistic Test p-value: 2.69E-14; Z-score: 6.44E+00

Methylation in Case

 3.44E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg03405781)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.58E-11; Z-score: -3.65E+00

Methylation in Case

 7.91E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC41A3 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg26446071)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.26E-09; Z-score: -2.72E+00

Methylation in Case

 6.38E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg25365006)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.35E-02; Z-score: 1.30E+00

Methylation in Case

 8.02E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg23085666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.87E-02; Z-score: -1.32E+00

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in lung adenocarcinoma [ 6 ]

Location

 TSS200 (cg24663845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.27E-04; Z-score: 2.28E+00

Methylation in Case

 7.65E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC41A3 in lung adenocarcinoma [ 6 ]

Location

 TSS200 (cg14598764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 6.21E-03; Z-score: 1.23E+00

Methylation in Case

 7.91E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC41A3 in lung adenocarcinoma [ 6 ]

Location

 TSS200 (cg20177385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.33E-02; Z-score: 1.13E+00

Methylation in Case

 6.23E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg08509840)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 4.54E-14; Z-score: 2.50E+00

Methylation in Case

 7.46E-01 (Median) Methylation in Control 6.21E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg14598764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 7.49E-06; Z-score: 1.29E+00

Methylation in Case

 8.05E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC41A3 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg24663845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.10E-05; Z-score: 1.36E+00

Methylation in Case

 7.41E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC41A3 in prostate cancer [ 8 ]

Location

 TSS1500 (cg04675747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 4.92E-03; Z-score: 3.66E+00

Methylation in Case

 6.67E-01 (Median) Methylation in Control 4.71E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC41A3 in prostate cancer [ 8 ]

Location

 TSS1500 (cg14427972)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.64E-02; Z-score: 1.66E+00

Methylation in Case

 8.61E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Anaplastic pilocytic astrocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC41A3 in anaplastic pilocytic astrocytoma than that in healthy individual

Studied Phenotype

 Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.16E-12; Fold-change: -0.24171686; Z-score: -1.140767182
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC41A3 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.19E-10; Fold-change: -0.282195709; Z-score: -1.189773826
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Brain neuroepithelial tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC41A3 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

 Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.51E-11; Fold-change: -0.253386305; Z-score: -1.461332918
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Atypical teratoid rhabdoid tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC41A3 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

 Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 5.67E-08; Fold-change: 0.340177045; Z-score: 1.338520019
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Anaplastic pleomorphic xanthoastrocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC41A3 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual

Studied Phenotype

 Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.45E-06; Fold-change: -0.401097878; Z-score: -1.695329903
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets SLC41A3 [ 9 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.