Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0360 Transporter Info
Gene Name	SLC43A1
Transporter Name	L-type amino acid transporter 3
Gene ID	8501
UniProt ID	O75387

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg07764959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.31E-07; Z-score: -1.10E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	9.30E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg08572535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 1.41E-07; Z-score: 1.42E+00
Methylation in Case	9.24E-01 (Median)	Methylation in Control	6.84E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.67E-05; Z-score: 6.62E-01
Methylation in Case	8.65E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.03E-04; Z-score: -1.05E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 7.45E-04; Z-score: -1.30E+00
Methylation in Case	4.08E-01 (Median)	Methylation in Control	5.28E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg09478995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 1.06E-02; Z-score: 6.65E-01
Methylation in Case	7.52E-01 (Median)	Methylation in Control	6.54E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg10964211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.95E-02; Z-score: 6.04E-01
Methylation in Case	8.60E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.19E-02; Z-score: 5.34E-01
Methylation in Case	4.22E-01 (Median)	Methylation in Control	3.70E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.85E-02; Z-score: -4.23E-01
Methylation in Case	8.29E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 1.49E-12; Z-score: -2.42E+00
Methylation in Case	4.63E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Breast cancer	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	5'UTR (cg08572535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 9.62E-06; Z-score: 1.04E+00
Methylation in Case	1.01E-01 (Median)	Methylation in Control	8.19E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	TSS1500 (cg26624118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.86E-04; Z-score: 8.08E-01
Methylation in Case	8.80E-02 (Median)	Methylation in Control	7.43E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	TSS1500 (cg05375277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 1.93E-02; Z-score: 5.56E-01
Methylation in Case	9.34E-03 (Median)	Methylation in Control	6.34E-03 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	TSS200 (cg14028489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.30E-02; Z-score: 3.94E-01
Methylation in Case	5.21E-03 (Median)	Methylation in Control	3.62E-03 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.64E+00	Statistic Test	p-value: 4.73E-25; Z-score: 6.51E+00
Methylation in Case	5.13E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.86E+00	Statistic Test	p-value: 5.92E-22; Z-score: 4.03E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.10E+00	Statistic Test	p-value: 7.28E-21; Z-score: 5.94E+00
Methylation in Case	4.57E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.12E+00	Statistic Test	p-value: 9.07E-20; Z-score: 4.05E+00
Methylation in Case	4.46E-01 (Median)	Methylation in Control	2.10E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 4.19E-19; Z-score: 3.27E+00
Methylation in Case	4.34E-01 (Median)	Methylation in Control	2.71E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 8.78E-18; Z-score: -2.95E+00
Methylation in Case	2.26E-01 (Median)	Methylation in Control	2.97E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 2.82E-15; Z-score: 4.14E+00
Methylation in Case	6.10E-01 (Median)	Methylation in Control	4.57E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.74E-11; Z-score: -2.83E+00
Methylation in Case	4.87E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.76E-07; Z-score: 1.09E+00
Methylation in Case	5.93E-01 (Median)	Methylation in Control	4.79E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 5.43E-07; Z-score: -1.43E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg17559156)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 6.87E-05; Z-score: -1.12E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	Body (cg09478995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.98E-02; Z-score: -4.50E-01
Methylation in Case	6.54E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC43A1 in breast cancer			[ 2 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.22E-03; Z-score: -8.75E-01
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg08572535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 3.67E-05; Z-score: 1.88E+00
Methylation in Case	7.50E-02 (Median)	Methylation in Control	5.50E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg07764959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 6.94E-03; Z-score: 5.63E-01
Methylation in Case	2.08E-02 (Median)	Methylation in Control	1.88E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg26624118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 8.22E-03; Z-score: 1.21E+00
Methylation in Case	3.00E-02 (Median)	Methylation in Control	2.35E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg05375277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 8.54E-03; Z-score: 8.60E-01
Methylation in Case	1.52E-02 (Median)	Methylation in Control	1.38E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg02037518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 9.32E-03; Z-score: 6.75E-01
Methylation in Case	1.75E-02 (Median)	Methylation in Control	1.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg17057783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.85E-02; Z-score: 4.39E-01
Methylation in Case	2.89E-02 (Median)	Methylation in Control	2.66E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg23409370)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.02E-02; Z-score: 2.17E-01
Methylation in Case	2.52E-02 (Median)	Methylation in Control	2.41E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.06E-09; Z-score: 4.10E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	5.66E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.37E+00	Statistic Test	p-value: 1.19E-06; Z-score: 1.70E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	7.43E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.04E+00	Statistic Test	p-value: 1.96E-06; Z-score: 1.47E+00
Methylation in Case	2.46E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 3.80E-06; Z-score: 1.50E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	2.29E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 6.19E-06; Z-score: 1.44E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	2.74E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.31E-02; Z-score: 1.28E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	6.45E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC43A1 in clear cell renal cell carcinoma			[ 3 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.02E-05; Z-score: -1.58E+00
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.55E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	5'UTR (cg00162231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 1.46E-06; Z-score: 1.81E+00
Methylation in Case	5.81E-01 (Median)	Methylation in Control	4.07E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	5'UTR (cg15374686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.08E-03; Z-score: 1.86E+00
Methylation in Case	6.23E-01 (Median)	Methylation in Control	5.24E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	5'UTR (cg18003231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.29E-03; Z-score: 5.10E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg05331214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.69E+00	Statistic Test	p-value: 7.16E-08; Z-score: -8.23E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg09456905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 2.17E-06; Z-score: -2.27E+00
Methylation in Case	5.06E-01 (Median)	Methylation in Control	6.24E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg09432234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.26E-03; Z-score: -1.01E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg13188098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.72E-05; Z-score: 1.88E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	3.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg27648056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 3.61E-06; Z-score: -3.11E+00
Methylation in Case	5.81E-01 (Median)	Methylation in Control	7.49E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg00981877)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 4.86E-06; Z-score: -1.32E+00
Methylation in Case	9.81E-02 (Median)	Methylation in Control	1.40E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg24131671)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.51E-05; Z-score: -1.88E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	6.79E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg11981631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 2.69E-03; Z-score: 1.96E+00
Methylation in Case	1.85E-01 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg08225137)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.84E-03; Z-score: -1.10E+00
Methylation in Case	7.95E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in colon adenocarcinoma			[ 4 ]
Location	3'UTR (cg02497486)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.42E-03; Z-score: 8.78E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg08572535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 2.56E-05; Z-score: -7.27E-01
Methylation in Case	7.82E-02 (Median)	Methylation in Control	9.22E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg17363443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 6.73E-03; Z-score: -6.60E-01
Methylation in Case	7.61E-02 (Median)	Methylation in Control	8.40E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg17958577)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 3.91E-13; Z-score: -3.77E+00
Methylation in Case	5.78E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg09478995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 3.57E-09; Z-score: -1.72E+00
Methylation in Case	4.44E-01 (Median)	Methylation in Control	5.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 2.27E-08; Z-score: -1.45E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.58E-06; Z-score: -1.12E+00
Methylation in Case	3.29E-01 (Median)	Methylation in Control	4.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg10964211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.08E-06; Z-score: 6.40E-01
Methylation in Case	8.19E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 6.27E-06; Z-score: -1.02E+00
Methylation in Case	2.48E-01 (Median)	Methylation in Control	3.44E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 7.55E-06; Z-score: -9.20E-01
Methylation in Case	2.93E-01 (Median)	Methylation in Control	3.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 8.86E-06; Z-score: -1.21E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	2.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 2.35E-05; Z-score: -1.03E+00
Methylation in Case	1.88E-01 (Median)	Methylation in Control	2.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 6.64E-05; Z-score: -1.16E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	4.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.44E-03; Z-score: -9.57E-01
Methylation in Case	3.61E-01 (Median)	Methylation in Control	4.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg17559156)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.72E-02; Z-score: -1.17E+00
Methylation in Case	4.42E-01 (Median)	Methylation in Control	5.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC43A1 in hepatocellular carcinoma			[ 5 ]
Location	3'UTR (cg19991086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 6.46E-12; Z-score: -2.77E+00
Methylation in Case	5.47E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	5'UTR (cg08572535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 5.27E-05; Z-score: 1.44E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	9.37E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	TSS1500 (cg05375277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.57E+00	Statistic Test	p-value: 2.87E-03; Z-score: 9.41E-01
Methylation in Case	1.16E-02 (Median)	Methylation in Control	7.34E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	TSS200 (cg02037518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 1.22E-02; Z-score: 9.27E-01
Methylation in Case	9.08E-03 (Median)	Methylation in Control	4.79E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	TSS200 (cg17057783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 3.54E-02; Z-score: 7.25E-01
Methylation in Case	4.05E-02 (Median)	Methylation in Control	3.39E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 6.73E-14; Z-score: 4.77E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	4.97E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.71E-11; Z-score: 1.56E+00
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 1.78E-07; Z-score: 2.53E+00
Methylation in Case	2.39E-01 (Median)	Methylation in Control	1.64E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 7.04E-07; Z-score: 1.61E+00
Methylation in Case	6.35E-01 (Median)	Methylation in Control	5.20E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 9.09E-06; Z-score: 1.23E+00
Methylation in Case	5.96E-01 (Median)	Methylation in Control	5.55E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 9.45E-06; Z-score: 1.40E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	4.88E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 4.28E-05; Z-score: 1.31E+00
Methylation in Case	5.83E-01 (Median)	Methylation in Control	4.92E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.64E-03; Z-score: 7.05E-01
Methylation in Case	5.08E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in HIV infection			[ 6 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 4.30E-10; Z-score: 3.11E+00
Methylation in Case	6.91E-01 (Median)	Methylation in Control	4.42E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.20E-07; Z-score: -1.06E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	5'UTR (cg16405055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.37E-02; Z-score: -6.62E-02
Methylation in Case	3.84E-02 (Median)	Methylation in Control	3.91E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg01826863)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 8.98E-22; Z-score: 5.90E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	2.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg15828524)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 8.16E-05; Z-score: 1.07E+00
Methylation in Case	8.65E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg19777783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.22E-02; Z-score: -7.80E-01
Methylation in Case	6.11E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg09210286)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 1.93E-15; Z-score: 3.07E+00
Methylation in Case	9.01E-02 (Median)	Methylation in Control	6.48E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg13044838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.79E-09; Z-score: 1.89E+00
Methylation in Case	8.46E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg20422819)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 6.55E-06; Z-score: 1.50E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	6.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg20244340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 5.98E-03; Z-score: -1.10E+00
Methylation in Case	2.53E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg26572770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 6.20E-03; Z-score: -3.38E-01
Methylation in Case	7.33E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg25213968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.42E-02; Z-score: -5.69E-01
Methylation in Case	7.02E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg20869999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.53E-02; Z-score: 2.28E-01
Methylation in Case	5.88E-01 (Median)	Methylation in Control	5.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC43A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	3'UTR (cg12468553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.44E-02; Z-score: 2.83E-01
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg26624118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.29E-03; Z-score: 7.02E-01
Methylation in Case	1.01E-01 (Median)	Methylation in Control	9.30E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	TSS200 (cg23409370)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 4.00E-05; Z-score: -1.16E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	TSS200 (cg14028489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.87E-03; Z-score: 7.29E-01
Methylation in Case	1.01E-02 (Median)	Methylation in Control	8.31E-03 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	TSS200 (cg17057783)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.81E-02; Z-score: -3.18E-01
Methylation in Case	3.08E-02 (Median)	Methylation in Control	3.43E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 6.68E-04; Z-score: 1.20E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	3.68E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.49E-03; Z-score: -1.36E+00
Methylation in Case	2.91E-01 (Median)	Methylation in Control	3.45E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 1.92E-03; Z-score: 8.18E-01
Methylation in Case	2.29E-01 (Median)	Methylation in Control	1.69E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 2.04E-03; Z-score: 1.06E+00
Methylation in Case	3.33E-01 (Median)	Methylation in Control	2.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 2.17E-03; Z-score: 8.13E-01
Methylation in Case	1.88E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 3.75E-03; Z-score: 8.32E-01
Methylation in Case	3.98E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 7.70E-03; Z-score: 6.39E-01
Methylation in Case	4.25E-01 (Median)	Methylation in Control	3.60E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC43A1 in colorectal cancer			[ 8 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.86E-02; Z-score: -9.69E-01
Methylation in Case	7.46E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg26624118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.60E-03; Z-score: -6.78E-01
Methylation in Case	6.80E-02 (Median)	Methylation in Control	7.46E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg23409370)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 5.89E-03; Z-score: -6.41E-01
Methylation in Case	5.68E-02 (Median)	Methylation in Control	6.48E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg10964211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.52E-10; Z-score: -2.12E+00
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg09478995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.34E-07; Z-score: 1.49E+00
Methylation in Case	5.49E-01 (Median)	Methylation in Control	4.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 5.37E-05; Z-score: 5.91E-01
Methylation in Case	5.36E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 8.49E-05; Z-score: 1.13E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.59E-03; Z-score: -6.98E-01
Methylation in Case	9.47E-01 (Median)	Methylation in Control	9.54E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 3.65E-02; Z-score: 6.62E-01
Methylation in Case	2.65E-01 (Median)	Methylation in Control	2.13E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 3.78E-02; Z-score: 6.10E-01
Methylation in Case	1.91E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.29E-02; Z-score: -5.41E-01
Methylation in Case	1.88E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	TSS1500 (cg20408693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.63E+00	Statistic Test	p-value: 2.40E-03; Z-score: 2.79E+01
Methylation in Case	5.36E-01 (Median)	Methylation in Control	9.52E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	TSS200 (cg19766441)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.64E+00	Statistic Test	p-value: 3.25E-03; Z-score: 1.38E+01
Methylation in Case	5.37E-01 (Median)	Methylation in Control	8.09E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	TSS200 (cg23365801)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 8.34E-03; Z-score: 2.69E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	3.71E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg10423743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.92E-04; Z-score: 4.48E+00
Methylation in Case	9.52E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg09478995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 3.63E-03; Z-score: -4.03E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg09565111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 4.07E-03; Z-score: -4.09E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	6.03E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.18E+00	Statistic Test	p-value: 4.55E-03; Z-score: 3.09E+00
Methylation in Case	7.30E-01 (Median)	Methylation in Control	3.35E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg02902412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 5.73E-03; Z-score: 3.23E+00
Methylation in Case	9.40E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in prostate cancer			[ 10 ]
Location	Body (cg16296843)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.97E-02; Z-score: -3.96E+00
Methylation in Case	4.37E-01 (Median)	Methylation in Control	5.62E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	TSS1500 (cg05375277)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.22E-02; Z-score: 1.30E-01
Methylation in Case	1.32E-02 (Median)	Methylation in Control	1.26E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	TSS200 (cg18004239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.98E-02; Z-score: 1.44E-01
Methylation in Case	5.35E-02 (Median)	Methylation in Control	5.18E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.99E-03; Z-score: -3.30E-01
Methylation in Case	2.73E-01 (Median)	Methylation in Control	2.99E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg10964211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.58E-02; Z-score: 2.10E-01
Methylation in Case	8.03E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.29E-02; Z-score: -1.84E-01
Methylation in Case	9.03E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.87E-02; Z-score: -3.10E-01
Methylation in Case	5.66E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg11376147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.72E+00	Statistic Test	p-value: 2.74E-12; Z-score: -1.15E+01
Methylation in Case	1.66E-01 (Median)	Methylation in Control	2.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 1.52E-06; Z-score: 4.54E+00
Methylation in Case	6.37E-01 (Median)	Methylation in Control	4.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 3.52E-06; Z-score: -2.70E+01
Methylation in Case	6.39E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 3.62E-06; Z-score: -4.01E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	5.46E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg17559156)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 9.22E-04; Z-score: -2.74E+00
Methylation in Case	5.14E-01 (Median)	Methylation in Control	7.12E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg24733435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.59E-03; Z-score: -1.65E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.05E-03; Z-score: -2.12E+00
Methylation in Case	3.28E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg10964211)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.32E-03; Z-score: -2.32E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 8.42E-03; Z-score: -1.82E+00
Methylation in Case	2.43E-01 (Median)	Methylation in Control	3.29E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.73E-02; Z-score: -6.56E-01
Methylation in Case	2.97E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC43A1 in bladder cancer			[ 12 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.64E+00	Statistic Test	p-value: 4.90E-02; Z-score: -1.85E+00
Methylation in Case	1.42E-01 (Median)	Methylation in Control	2.33E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in celiac disease			[ 13 ]
Location	Body (cg04431596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.50E+00	Statistic Test	p-value: 4.74E-02; Z-score: 1.27E+00
Methylation in Case	5.83E-01 (Median)	Methylation in Control	2.33E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg23075364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 2.62E-04; Z-score: 3.86E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	3.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 2.82E-04; Z-score: 2.81E+00
Methylation in Case	5.87E-01 (Median)	Methylation in Control	4.64E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg26418434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.38E-04; Z-score: 2.48E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg02680086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 7.34E-04; Z-score: 4.59E+00
Methylation in Case	5.10E-01 (Median)	Methylation in Control	3.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg00089550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.93E-02; Z-score: 1.31E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC43A1 in lung adenocarcinoma			[ 14 ]
Location	Body (cg25284762)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 2.73E-02; Z-score: 2.62E+00
Methylation in Case	6.30E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC43A1 in panic disorder			[ 15 ]
Location	Body (cg17330838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+01	Statistic Test	p-value: 5.15E-03; Z-score: -4.82E-01
Methylation in Case	-6.35E-03 (Median)	Methylation in Control	8.04E-02 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC43A1 in panic disorder			[ 15 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E-01	Statistic Test	p-value: 1.55E-02; Z-score: -4.15E-01
Methylation in Case	-1.75E-01 (Median)	Methylation in Control	-2.43E-02 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC43A1 in panic disorder			[ 15 ]
Location	3'UTR (cg09888840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -7.73E-01	Statistic Test	p-value: 1.83E-02; Z-score: -3.33E-01
Methylation in Case	-1.00E+00 (Median)	Methylation in Control	-7.74E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1226 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1226	miRNA Mature ID	miR-1226-3p
miRNA Sequence	UCACCAGCCCUGUGUUCCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1238 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1238	miRNA Mature ID	miR-1238-3p
miRNA Sequence	CUUCCUCGUCUGUCUGCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1304 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-204 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-204	miRNA Mature ID	miR-204-5p
miRNA Sequence	UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-211 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-211	miRNA Mature ID	miR-211-5p
miRNA Sequence	UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-27b directly targets SLC43A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-27b	miRNA Mature ID	miR-27b-3p
miRNA Sequence	UUCACAGUGGCUAAGUUCUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-4676 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4676	miRNA Mature ID	miR-4676-5p
miRNA Sequence	GAGCCAGUGGUGAGACAGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-4755 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-5p
miRNA Sequence	UUUCCCUUCAGAGCCUGGCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-484 directly targets SLC43A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-484	miRNA Mature ID	miR-484
miRNA Sequence	UCAGGCUCAGUCCCCUCCCGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-5006 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5006	miRNA Mature ID	miR-5006-3p
miRNA Sequence	UUUCCCUUUCCAUCCUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-521 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-521	miRNA Mature ID	miR-521
miRNA Sequence	AACGCACUUCCCUUUAGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-575 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-575	miRNA Mature ID	miR-575
miRNA Sequence	GAGCCAGUUGGACAGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-623 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-623	miRNA Mature ID	miR-623
miRNA Sequence	AUCCCUUGCAGGGGCUGUUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-670 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-670	miRNA Mature ID	miR-670-3p
miRNA Sequence	UUUCCUCAUAUUCAUUCAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-6832 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-3p
miRNA Sequence	ACCCUUUUUCUCUUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-6881 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6881	miRNA Mature ID	miR-6881-3p
miRNA Sequence	AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-7111 directly targets SLC43A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-3p
miRNA Sequence	AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	DNA Methylation Dynamics in Urological Tumors.
13	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
14	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
17	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence