Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0362 Transporter Info | ||||
Gene Name | SLC43A3 | ||||
Transporter Name | Equilibrative nucleobase transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
47 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-124 directly targets SLC43A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-1248 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1248 | miRNA Mature ID | miR-1248 | ||
miRNA Sequence |
ACCUUCUUGUAUAAGCACUGUGCUAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-147a directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-147a | miRNA Mature ID | miR-147a | ||
miRNA Sequence |
GUGUGUGGAAAUGCUUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 4 |
miR-186 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-188 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-188 | miRNA Mature ID | miR-188-5p | ||
miRNA Sequence |
CAUCCCUUGCAUGGUGGAGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-19a directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-19a | miRNA Mature ID | miR-19a-5p | ||
miRNA Sequence |
AGUUUUGCAUAGUUGCACUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 7 |
miR-2052 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2052 | miRNA Mature ID | miR-2052 | ||
miRNA Sequence |
UGUUUUGAUAACAGUAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 8 |
miR-2113 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-2113 | miRNA Mature ID | miR-2113 | ||
miRNA Sequence |
AUUUGUGCUUGGCUCUGUCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 9 |
miR-215 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-3p | ||
miRNA Sequence |
UCUGUCAUUUCUUUAGGCCAAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-365a directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-3p | ||
miRNA Sequence |
UAAUGCCCCUAAAAAUCCUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-365b directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-3p | ||
miRNA Sequence |
UAAUGCCCCUAAAAAUCCUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-3688 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3688 | miRNA Mature ID | miR-3688-5p | ||
miRNA Sequence |
AGUGGCAAAGUCUUUCCAUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-3973 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3973 | miRNA Mature ID | miR-3973 | ||
miRNA Sequence |
ACAAAGUACAGCAUUAGCCUUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4455 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4455 | miRNA Mature ID | miR-4455 | ||
miRNA Sequence |
AGGGUGUGUGUGUUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 15 |
miR-4635 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4635 | miRNA Mature ID | miR-4635 | ||
miRNA Sequence |
UCUUGAAGUCAGAACCCGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-4731 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 17 |
miR-5010 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5010 | miRNA Mature ID | miR-5010-3p | ||
miRNA Sequence |
UUUUGUGUCUCCCAUUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 18 |
miR-5088 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5088 | miRNA Mature ID | miR-5088-3p | ||
miRNA Sequence |
UCCCUUCUUCCUGGGCCCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-5191 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5191 | miRNA Mature ID | miR-5191 | ||
miRNA Sequence |
AGGAUAGGAAGAAUGAAGUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-526b directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-5p | ||
miRNA Sequence |
CUCUUGAGGGAAGCACUUUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-548a directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548a | miRNA Mature ID | miR-548a-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGAGUUUUACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-548ab directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548ab | miRNA Mature ID | miR-548ab | ||
miRNA Sequence |
AAAAGUAAUUGUGGAUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-548ak directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548ak | miRNA Mature ID | miR-548ak | ||
miRNA Sequence |
AAAAGUAACUGCGGUUUUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-548b directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548b | miRNA Mature ID | miR-548b-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-548c directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-548d directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548d | miRNA Mature ID | miR-548d-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-548h directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548h | miRNA Mature ID | miR-548h-5p | ||
miRNA Sequence |
AAAAGUAAUCGCGGUUUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-548i directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548i | miRNA Mature ID | miR-548i | ||
miRNA Sequence |
AAAAGUAAUUGCGGAUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-548j directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548j | miRNA Mature ID | miR-548j-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUCUUUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-548o directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548o | miRNA Mature ID | miR-548o-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-548w directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548w | miRNA Mature ID | miR-548w | ||
miRNA Sequence |
AAAAGUAACUGCGGUUUUUGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-548y directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548y | miRNA Mature ID | miR-548y | ||
miRNA Sequence |
AAAAGUAAUCACUGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-5589 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 34 |
miR-559 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-559 | miRNA Mature ID | miR-559 | ||
miRNA Sequence |
UAAAGUAAAUAUGCACCAAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-5692a directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5692a | miRNA Mature ID | miR-5692a | ||
miRNA Sequence |
CAAAUAAUACCACAGUGGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 36 |
miR-570 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-3p | ||
miRNA Sequence |
CGAAAACAGCAAUUACCUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 37 |
miR-574 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 38 |
miR-6083 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6083 | miRNA Mature ID | miR-6083 | ||
miRNA Sequence |
CUUAUAUCAGAGGCUGUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 39 |
miR-619 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 40 |
miR-6506 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 41 |
miR-6729 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6729 | miRNA Mature ID | miR-6729-3p | ||
miRNA Sequence |
UCAUCCCCCUCGCCCUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-6773 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-3p | ||
miRNA Sequence |
ACUGUCACUUCUCUGCCCAUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 43 |
miR-6793 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6793 | miRNA Mature ID | miR-6793-3p | ||
miRNA Sequence |
UCCCCAACCCCUGCCCGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 44 |
miR-6818 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6818 | miRNA Mature ID | miR-6818-5p | ||
miRNA Sequence |
UUGUGUGAGUACAGAGAGCAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 45 |
miR-6866 directly targets SLC43A3 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6866 | miRNA Mature ID | miR-6866-3p | ||
miRNA Sequence |
GAUCCCUUUAUCUGUCCUCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 46 |
miR-6867 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 47 |
miR-6885 directly targets SLC43A3 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6885 | miRNA Mature ID | miR-6885-3p | ||
miRNA Sequence |
CUUUGCUUCCUGCUCCCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Methylation |
|||||
Squamous cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC43A3 in squamous cell carcinoma than that in healthy individual | ||||
Studied Phenotype |
Squamous cell carcinoma [ICD-11:2B60] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.29E-07; Fold-change: 0.262036512; Z-score: 2.943227525 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC43A3 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.59E-24; Fold-change: -0.210584048; Z-score: -2.940762019 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Myxopapillary ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC43A3 in myxopapillary ependymoma than that in healthy individual | ||||
Studied Phenotype |
Myxopapillary ependymoma [ICD-11:2A00.5] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.020976888; Fold-change: -0.22977434; Z-score: -0.701827494 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC43A3 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.16E-19; Fold-change: -0.205056542; Z-score: -2.740973444 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC43A3 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.87E-24; Fold-change: -0.506197241; Z-score: -4.467509058 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC43A3 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.99E-11; Fold-change: -0.315102081; Z-score: -3.736462 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC43A3 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.95E-13; Fold-change: -0.872575744; Z-score: -28.02119426 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Craniopharyngioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC43A3 in craniopharyngioma than that in healthy individual | ||||
Studied Phenotype |
Craniopharyngioma [ICD-11:2F9A] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 7.78E-21; Fold-change: -0.368303074; Z-score: -3.338689709 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC43A3 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.44E-199; Fold-change: -0.467298202; Z-score: -5.931046605 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC43A3 in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 0.035047044; Fold-change: 0.516748781; Z-score: 3.182408984 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.