Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0362 Transporter Info
Gene Name	SLC43A3
Transporter Name	Equilibrative nucleobase transporter 1
Gene ID	29015
UniProt ID	Q8NBI5

Epigenetic Regulations of This DT (EGR)
microRNA
Unclear Phenotype	47 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-124 directly targets SLC43A3			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 2	miR-1248 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1248	miRNA Mature ID	miR-1248
miRNA Sequence	ACCUUCUUGUAUAAGCACUGUGCUAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-147a directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-147a	miRNA Mature ID	miR-147a
miRNA Sequence	GUGUGUGGAAAUGCUUCUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 4	miR-186 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-3p
miRNA Sequence	GCCCAAAGGUGAAUUUUUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-188 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-188	miRNA Mature ID	miR-188-5p
miRNA Sequence	CAUCCCUUGCAUGGUGGAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-19a directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-5p
miRNA Sequence	AGUUUUGCAUAGUUGCACUACA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 7	miR-2052 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2052	miRNA Mature ID	miR-2052
miRNA Sequence	UGUUUUGAUAACAGUAAUGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 8	miR-2113 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2113	miRNA Mature ID	miR-2113
miRNA Sequence	AUUUGUGCUUGGCUCUGUCAC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 9	miR-215 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-215	miRNA Mature ID	miR-215-3p
miRNA Sequence	UCUGUCAUUUCUUUAGGCCAAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-365a directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365a	miRNA Mature ID	miR-365a-3p
miRNA Sequence	UAAUGCCCCUAAAAAUCCUUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-365b directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365b	miRNA Mature ID	miR-365b-3p
miRNA Sequence	UAAUGCCCCUAAAAAUCCUUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3688 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3688	miRNA Mature ID	miR-3688-5p
miRNA Sequence	AGUGGCAAAGUCUUUCCAUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-3973 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3973	miRNA Mature ID	miR-3973
miRNA Sequence	ACAAAGUACAGCAUUAGCCUUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4455 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4455	miRNA Mature ID	miR-4455
miRNA Sequence	AGGGUGUGUGUGUUUUU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 15	miR-4635 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4635	miRNA Mature ID	miR-4635
miRNA Sequence	UCUUGAAGUCAGAACCCGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4731 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4731	miRNA Mature ID	miR-4731-5p
miRNA Sequence	UGCUGGGGGCCACAUGAGUGUG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 17	miR-5010 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5010	miRNA Mature ID	miR-5010-3p
miRNA Sequence	UUUUGUGUCUCCCAUUCCCCAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 18	miR-5088 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5088	miRNA Mature ID	miR-5088-3p
miRNA Sequence	UCCCUUCUUCCUGGGCCCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-5191 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5191	miRNA Mature ID	miR-5191
miRNA Sequence	AGGAUAGGAAGAAUGAAGUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-526b directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-5p
miRNA Sequence	CUCUUGAGGGAAGCACUUUCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-548a directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548a	miRNA Mature ID	miR-548a-5p
miRNA Sequence	AAAAGUAAUUGCGAGUUUUACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-548ab directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548ab	miRNA Mature ID	miR-548ab
miRNA Sequence	AAAAGUAAUUGUGGAUUUUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-548ak directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548ak	miRNA Mature ID	miR-548ak
miRNA Sequence	AAAAGUAACUGCGGUUUUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-548b directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548b	miRNA Mature ID	miR-548b-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-548c directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-548d directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548d	miRNA Mature ID	miR-548d-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-548h directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548h	miRNA Mature ID	miR-548h-5p
miRNA Sequence	AAAAGUAAUCGCGGUUUUUGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-548i directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548i	miRNA Mature ID	miR-548i
miRNA Sequence	AAAAGUAAUUGCGGAUUUUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-548j directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548j	miRNA Mature ID	miR-548j-5p
miRNA Sequence	AAAAGUAAUUGCGGUCUUUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-548o directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548o	miRNA Mature ID	miR-548o-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-548w directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548w	miRNA Mature ID	miR-548w
miRNA Sequence	AAAAGUAACUGCGGUUUUUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-548y directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548y	miRNA Mature ID	miR-548y
miRNA Sequence	AAAAGUAAUCACUGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-5589 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-5p
miRNA Sequence	GGCUGGGUGCUCUUGUGCAGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 34	miR-559 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-559	miRNA Mature ID	miR-559
miRNA Sequence	UAAAGUAAAUAUGCACCAAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-5692a directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5692a	miRNA Mature ID	miR-5692a
miRNA Sequence	CAAAUAAUACCACAGUGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-570 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-570	miRNA Mature ID	miR-570-3p
miRNA Sequence	CGAAAACAGCAAUUACCUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-574 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-574	miRNA Mature ID	miR-574-5p
miRNA Sequence	UGAGUGUGUGUGUGUGAGUGUGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 38	miR-6083 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6083	miRNA Mature ID	miR-6083
miRNA Sequence	CUUAUAUCAGAGGCUGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-619 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-5p
miRNA Sequence	GCUGGGAUUACAGGCAUGAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-6506 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6506	miRNA Mature ID	miR-6506-5p
miRNA Sequence	ACUGGGAUGUCACUGAAUAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-6729 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6729	miRNA Mature ID	miR-6729-3p
miRNA Sequence	UCAUCCCCCUCGCCCUCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-6773 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6773	miRNA Mature ID	miR-6773-3p
miRNA Sequence	ACUGUCACUUCUCUGCCCAUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-6793 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6793	miRNA Mature ID	miR-6793-3p
miRNA Sequence	UCCCCAACCCCUGCCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-6818 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6818	miRNA Mature ID	miR-6818-5p
miRNA Sequence	UUGUGUGAGUACAGAGAGCAUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 45	miR-6866 directly targets SLC43A3			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6866	miRNA Mature ID	miR-6866-3p
miRNA Sequence	GAUCCCUUUAUCUGUCCUCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-6867 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-5p
miRNA Sequence	UGUGUGUGUAGAGGAAGAAGGGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 47	miR-6885 directly targets SLC43A3			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6885	miRNA Mature ID	miR-6885-3p
miRNA Sequence	CUUUGCUUCCUGCUCCCCUAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Methylation
Squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC43A3 in squamous cell carcinoma than that in healthy individual
Studied Phenotype	Squamous cell carcinoma [ICD-11:2B60]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.29E-07; Fold-change: 0.262036512; Z-score: 2.943227525
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC43A3 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.59E-24; Fold-change: -0.210584048; Z-score: -2.940762019
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Myxopapillary ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC43A3 in myxopapillary ependymoma than that in healthy individual
Studied Phenotype	Myxopapillary ependymoma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.020976888; Fold-change: -0.22977434; Z-score: -0.701827494
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC43A3 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.16E-19; Fold-change: -0.205056542; Z-score: -2.740973444
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC43A3 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.87E-24; Fold-change: -0.506197241; Z-score: -4.467509058
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC43A3 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.99E-11; Fold-change: -0.315102081; Z-score: -3.736462
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC43A3 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.95E-13; Fold-change: -0.872575744; Z-score: -28.02119426
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC43A3 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.78E-21; Fold-change: -0.368303074; Z-score: -3.338689709
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC43A3 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.44E-199; Fold-change: -0.467298202; Z-score: -5.931046605
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC43A3 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 0.035047044; Fold-change: 0.516748781; Z-score: 3.182408984
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual

References
1	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
2	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
3	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence