Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0364 Transporter Info | ||||
Gene Name | SLC44A2 | ||||
Transporter Name | Choline transporter-like protein 2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg26489057) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 3.44E-02; Z-score: 2.52E+00 | ||
Methylation in Case |
2.28E-01 (Median) | Methylation in Control | 1.88E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in bladder cancer | [ 1 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -3.92E+00 | Statistic Test | p-value: 5.56E-13; Z-score: -1.22E+01 | ||
Methylation in Case |
1.61E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in bladder cancer | [ 1 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.20E-04; Z-score: -2.67E+00 | ||
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg26489057) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 2.12E+00 | Statistic Test | p-value: 1.53E-14; Z-score: 4.29E+00 | ||
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in breast cancer | [ 2 ] | |||
Location |
TSS1500 (cg19392998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 2.29E+00 | Statistic Test | p-value: 3.57E-12; Z-score: 2.94E+00 | ||
Methylation in Case |
2.35E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in breast cancer | [ 2 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 7.32E-11; Z-score: -2.11E+00 | ||
Methylation in Case |
4.27E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in breast cancer | [ 2 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.90E-05; Z-score: -9.00E-01 | ||
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC44A2 in breast cancer | [ 2 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.99E+00 | Statistic Test | p-value: 3.47E-04; Z-score: -1.68E+00 | ||
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg26489057) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.25E-02; Z-score: -7.35E-01 | ||
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in clear cell renal cell carcinoma | [ 3 ] | |||
Location |
Body (cg12156831) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.76E-03; Z-score: 5.19E-01 | ||
Methylation in Case |
1.46E-02 (Median) | Methylation in Control | 1.39E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg14792002) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.17E-02; Z-score: -6.70E-01 | ||
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.64E+00 | Statistic Test | p-value: 7.19E-12; Z-score: -2.89E+00 | ||
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 6.90E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.85E-08; Z-score: -2.90E+00 | ||
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg01247891) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 3.75E-01 | ||
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 1.37E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
TSS1500 (cg19392998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 2.64E-03; Z-score: 7.06E-01 | ||
Methylation in Case |
2.05E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 3.43E+00 | Statistic Test | p-value: 1.06E-09; Z-score: 5.63E+00 | ||
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 9.87E-02 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.51E-04; Z-score: -1.05E+00 | ||
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
Body (cg01247891) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.04E-03; Z-score: 9.92E-01 | ||
Methylation in Case |
9.13E-02 (Median) | Methylation in Control | 7.74E-02 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
Body (cg15503663) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 7.27E-03; Z-score: 7.25E-01 | ||
Methylation in Case |
1.23E-02 (Median) | Methylation in Control | 9.60E-03 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 6 |
Methylation of SLC44A2 in HIV infection | [ 5 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 3.66E-02; Z-score: 8.48E-01 | ||
Methylation in Case |
6.64E-02 (Median) | Methylation in Control | 5.37E-02 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg26489057) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 7.10E-03; Z-score: 1.04E+00 | ||
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 3.34E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg19392998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.95E-02; Z-score: 6.05E-01 | ||
Methylation in Case |
2.54E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.18E-04; Z-score: -9.35E-01 | ||
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 5.34E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.10E-04; Z-score: -9.10E-01 | ||
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC44A2 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg01247891) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.28E-04; Z-score: -7.18E-01 | ||
Methylation in Case |
5.85E-02 (Median) | Methylation in Control | 6.48E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in systemic lupus erythematosus | [ 7 ] | |||
Location |
TSS200 (cg05567294) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.52E-02; Z-score: -1.44E-01 | ||
Methylation in Case |
1.85E-01 (Median) | Methylation in Control | 1.95E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in systemic lupus erythematosus | [ 7 ] | |||
Location |
Body (cg15503663) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.19E-02; Z-score: -1.18E-01 | ||
Methylation in Case |
1.08E-02 (Median) | Methylation in Control | 1.12E-02 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in atypical teratoid rhabdoid tumor | [ 8 ] | |||
Location |
Body (cg01247891) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 5.68E-05; Z-score: -1.02E+00 | ||
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.19E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in atypical teratoid rhabdoid tumor | [ 8 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.09E-03; Z-score: 2.31E-01 | ||
Methylation in Case |
8.17E-02 (Median) | Methylation in Control | 6.68E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in atypical teratoid rhabdoid tumor | [ 8 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.64E-03; Z-score: 7.08E-01 | ||
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in atypical teratoid rhabdoid tumor | [ 8 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.14E-02; Z-score: -1.32E-01 | ||
Methylation in Case |
2.94E-02 (Median) | Methylation in Control | 3.33E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC44A2 in atypical teratoid rhabdoid tumor | [ 8 ] | |||
Location |
Body (cg12156831) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.68E-02; Z-score: -6.74E-02 | ||
Methylation in Case |
1.34E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in colon adenocarcinoma | [ 9 ] | |||
Location |
Body (cg01550915) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 4.48E-04; Z-score: -3.31E+00 | ||
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in depression | [ 10 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.22E-02; Z-score: -2.19E-01 | ||
Methylation in Case |
6.05E-02 (Median) | Methylation in Control | 6.28E-02 (Median) | ||
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in hepatocellular carcinoma | [ 11 ] | |||
Location |
Body (cg08275454) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 6.14E-09; Z-score: -1.73E+00 | ||
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in hepatocellular carcinoma | [ 11 ] | |||
Location |
Body (cg11345505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 7.82E-06; Z-score: 1.29E+00 | ||
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 3.94E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in hepatocellular carcinoma | [ 11 ] | |||
Location |
Body (cg01247891) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.97E-03; Z-score: 2.31E-02 | ||
Methylation in Case |
8.64E-02 (Median) | Methylation in Control | 8.58E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in hepatocellular carcinoma | [ 11 ] | |||
Location |
Body (cg15503663) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.75E-03; Z-score: -2.86E-02 | ||
Methylation in Case |
2.43E-02 (Median) | Methylation in Control | 2.47E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
Methylation of SLC44A2 in hepatocellular carcinoma | [ 11 ] | |||
Location |
Body (cg12156831) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 4.05E-02 | ||
Methylation in Case |
2.17E-02 (Median) | Methylation in Control | 2.13E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in pancretic ductal adenocarcinoma | [ 12 ] | |||
Location |
Body (cg17836790) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.24E-08; Z-score: 1.30E+00 | ||
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in pancretic ductal adenocarcinoma | [ 12 ] | |||
Location |
Body (cg02614661) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 9.12E-06; Z-score: -1.28E+00 | ||
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in panic disorder | [ 13 ] | |||
Location |
Body (cg06943912) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -9.68E-01 | Statistic Test | p-value: 8.12E-03; Z-score: -2.23E-01 | ||
Methylation in Case |
-4.24E+00 (Median) | Methylation in Control | -4.10E+00 (Median) | ||
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC44A2 in prostate cancer | [ 14 ] | |||
Location |
Body (cg25543755) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 8.77E-04; Z-score: 3.94E+00 | ||
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 5.81E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC44A2 in prostate cancer | [ 14 ] | |||
Location |
Body (cg18949702) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 9.32E-03; Z-score: 2.57E+00 | ||
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 3 |
Methylation of SLC44A2 in prostate cancer | [ 14 ] | |||
Location |
Body (cg15035421) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 1.56E-02; Z-score: -8.15E+00 | ||
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.94E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 4 |
Methylation of SLC44A2 in prostate cancer | [ 14 ] | |||
Location |
3'UTR (cg08094280) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.20E-02; Z-score: 2.40E+00 | ||
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC44A2 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.71E-10; Fold-change: -0.259907327; Z-score: -0.985386494 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Vestibular melanotic schwannoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC44A2 in vestibular melanotic schwannoma than that in healthy individual | ||||
Studied Phenotype |
Vestibular melanotic schwannoma [ICD-11:2A02.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.046576913; Fold-change: -0.216972363; Z-score: -1.447537479 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
microRNA |
|||||
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-124 directly targets SLC44A2 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.