Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0370 Transporter Info
Gene Name SLC45A3
Transporter Name Solute carrier family 45 member 3
Gene ID
85414
UniProt ID
Q96JT2
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.01E-08; Z-score: -1.55E+00

Methylation in Case

 7.41E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.46E-07; Z-score: -1.35E+00

Methylation in Case

 3.21E-01 (Median) Methylation in Control 5.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 1.98E-07; Z-score: 1.20E+00

Methylation in Case

 2.41E-01 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13323097)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 5.59E-07; Z-score: 1.21E+00

Methylation in Case

 8.96E-01 (Median) Methylation in Control 7.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13791589)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 6.70E-07; Z-score: 1.21E+00

Methylation in Case

 7.50E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg16278077)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 1.70E-06; Z-score: -1.26E+00

Methylation in Case

 4.19E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg17504096)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 1.96E-06; Z-score: 1.19E+00

Methylation in Case

 7.14E-01 (Median) Methylation in Control 5.29E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg17723122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.40E+00 Statistic Test p-value: 2.18E-06; Z-score: -1.45E+00

Methylation in Case

 8.98E-02 (Median) Methylation in Control 4.85E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg25551287)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 9.58E-06; Z-score: -9.02E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg03374976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.96E-04; Z-score: 7.99E-01

Methylation in Case

 7.42E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg06832359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.98E-03; Z-score: 6.77E-01

Methylation in Case

 7.06E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.70E-02; Z-score: -3.94E-01

Methylation in Case

 7.88E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.26E-02; Z-score: -2.07E-01

Methylation in Case

 1.15E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC45A3 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg12638776)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.53E-11; Z-score: -2.11E+00

Methylation in Case

 7.60E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.85E+00 Statistic Test p-value: 6.85E-08; Z-score: -1.24E+01

Methylation in Case

 2.50E-01 (Median) Methylation in Control 4.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.58E+00 Statistic Test p-value: 1.96E-06; Z-score: -7.37E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 5'UTR (cg17723122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.72E+00 Statistic Test p-value: 9.59E-06; Z-score: -5.43E+00

Methylation in Case

 2.08E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 5'UTR (cg13791589)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 3.58E-02; Z-score: -1.35E+00

Methylation in Case

 2.02E-02 (Median) Methylation in Control 2.67E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11455040)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 3.07E-02; Z-score: -1.37E+00

Methylation in Case

 4.50E-02 (Median) Methylation in Control 6.74E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg21850691)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 6.90E-03; Z-score: -1.94E+00

Methylation in Case

 5.40E-02 (Median) Methylation in Control 6.47E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg12048674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 2.59E-02; Z-score: -1.64E+00

Methylation in Case

 6.35E-02 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 Body (cg06832359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.73E+00 Statistic Test p-value: 1.04E-13; Z-score: -1.45E+01

Methylation in Case

 3.22E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 Body (cg26894854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.35E-07; Z-score: -6.01E+00

Methylation in Case

 4.80E-01 (Median) Methylation in Control 5.93E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 Body (cg27568165)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 8.51E-07; Z-score: -8.85E+00

Methylation in Case

 4.11E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 4.07E-06; Z-score: -8.32E+00

Methylation in Case

 6.21E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC45A3 in bladder cancer [ 2 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 7.83E-05; Z-score: -6.10E+00

Methylation in Case

 5.42E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 1.17E-22; Z-score: 3.33E+00

Methylation in Case

 7.34E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 3.81E-16; Z-score: 3.78E+00

Methylation in Case

 5.53E-01 (Median) Methylation in Control 4.12E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 5'UTR (cg17723122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.42E-07; Z-score: -1.31E+00

Methylation in Case

 3.90E-01 (Median) Methylation in Control 5.18E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.19E-05; Z-score: -1.19E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 Body (cg27568165)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.73E-14; Z-score: 2.10E+00

Methylation in Case

 7.05E-01 (Median) Methylation in Control 5.70E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.41E-10; Z-score: 1.55E+00

Methylation in Case

 7.58E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.76E-07; Z-score: 1.35E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC45A3 in breast cancer [ 3 ]

Location

 3'UTR (cg12638776)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 3.03E-07; Z-score: -7.78E-01

Methylation in Case

 9.45E-02 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.40E-03; Z-score: 8.96E-01

Methylation in Case

 4.20E-01 (Median) Methylation in Control 3.85E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 1.56E-03; Z-score: 2.56E+00

Methylation in Case

 6.18E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg11961175)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 1.45E-02; Z-score: 5.79E-01

Methylation in Case

 6.95E-02 (Median) Methylation in Control 5.36E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.28E-03; Z-score: -5.99E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in colorectal cancer [ 5 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.12E-02; Z-score: -2.64E-01

Methylation in Case

 6.90E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg17284384)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.58E-02; Z-score: -2.11E-01

Methylation in Case

 2.31E-02 (Median) Methylation in Control 2.45E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in colorectal cancer [ 5 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.85E-03; Z-score: -4.01E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in depression [ 6 ]

Location

 5'UTR (cg17504096)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.56E-02; Z-score: 6.40E-01

Methylation in Case

 5.50E-02 (Median) Methylation in Control 5.13E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in depression [ 6 ]

Location

 TSS1500 (cg11455040)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.78E-02; Z-score: 5.02E-01

Methylation in Case

 8.15E-02 (Median) Methylation in Control 7.54E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in depression [ 6 ]

Location

 TSS200 (cg00305188)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.74E-02; Z-score: 5.47E-01

Methylation in Case

 7.64E-02 (Median) Methylation in Control 7.21E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg16278077)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.82E-07; Z-score: 7.14E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.92E-06; Z-score: 1.35E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 2.03E-03; Z-score: -9.11E-01

Methylation in Case

 4.66E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.18E-02; Z-score: 2.28E-01

Methylation in Case

 3.91E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg07061355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.68E+00 Statistic Test p-value: 2.11E-18; Z-score: -7.00E+00

Methylation in Case

 4.60E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg13945442)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 7.84E-21; Z-score: -4.35E+00

Methylation in Case

 4.05E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg00465739)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 2.11E-16; Z-score: -2.32E+00

Methylation in Case

 4.44E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg24121906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 3.28E-16; Z-score: -5.36E+00

Methylation in Case

 5.50E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg13988611)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 2.47E-15; Z-score: -2.76E+00

Methylation in Case

 4.80E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg26894854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 6.37E-08; Z-score: 1.45E+00

Methylation in Case

 5.82E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg03374976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.16E-05; Z-score: 7.54E-01

Methylation in Case

 5.07E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.71E-04; Z-score: 1.04E+00

Methylation in Case

 7.87E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC45A3 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg27568165)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.31E-02; Z-score: 4.59E-01

Methylation in Case

 7.49E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.28E-16; Z-score: 2.38E+00

Methylation in Case

 8.68E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 7.36E-10; Z-score: 2.38E+00

Methylation in Case

 5.45E-01 (Median) Methylation in Control 4.39E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.82E-03; Z-score: 9.12E-01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 5'UTR (cg17723122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.53E-02; Z-score: -8.57E-01

Methylation in Case

 7.18E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 TSS1500 (cg11961175)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 6.98E-05; Z-score: 1.52E+00

Methylation in Case

 1.63E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 TSS1500 (cg17284384)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 2.48E-03; Z-score: 7.72E-01

Methylation in Case

 1.61E-02 (Median) Methylation in Control 1.10E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 TSS200 (cg12048674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.01E-03; Z-score: 1.19E+00

Methylation in Case

 7.40E-02 (Median) Methylation in Control 5.74E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 Body (cg03374976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.25E-03; Z-score: -1.71E+00

Methylation in Case

 6.54E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC45A3 in HIV infection [ 8 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.31E-03; Z-score: 4.35E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 6.91E-03; Z-score: 1.79E+00

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02075570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.76E+00 Statistic Test p-value: 4.26E-04; Z-score: -2.66E+00

Methylation in Case

 7.77E-02 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg11455040)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 1.99E-03; Z-score: -1.83E+00

Methylation in Case

 1.22E-01 (Median) Methylation in Control 1.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg17284384)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.92E+00 Statistic Test p-value: 3.85E-03; Z-score: -1.94E+00

Methylation in Case

 3.23E-02 (Median) Methylation in Control 6.18E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg11961175)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 9.68E-03; Z-score: -9.09E-01

Methylation in Case

 1.95E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in lung adenocarcinoma [ 9 ]

Location

 Body (cg03374976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 7.38E-03; Z-score: 1.53E+00

Methylation in Case

 6.00E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in panic disorder [ 10 ]

Location

 5'UTR (cg17723122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 1.30E-03; Z-score: 7.02E-01

Methylation in Case

 1.59E+00 (Median) Methylation in Control 1.35E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in panic disorder [ 10 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.01E-01 Statistic Test p-value: 4.82E-02; Z-score: -3.47E-01

Methylation in Case

 -8.60E-01 (Median) Methylation in Control -7.75E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 5'UTR (cg10581876)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.30E-05; Z-score: -1.06E+00

Methylation in Case

 9.20E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 TSS200 (cg12048674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.69E-02; Z-score: 4.02E-01

Methylation in Case

 6.18E-02 (Median) Methylation in Control 5.78E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg12178904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.13E-05; Z-score: -8.58E-01

Methylation in Case

 8.77E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg26894854)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 5.22E-04; Z-score: 1.58E+00

Methylation in Case

 6.40E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg03374976)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.93E-03; Z-score: 8.37E-01

Methylation in Case

 5.33E-01 (Median) Methylation in Control 5.04E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.46E-03; Z-score: -3.80E-01

Methylation in Case

 8.24E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC45A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg27568165)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.69E-03; Z-score: -2.79E-01

Methylation in Case

 8.16E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 5'UTR (cg08639339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.41E-03; Z-score: 3.49E-01

Methylation in Case

 6.58E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 5'UTR (cg13323097)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 5.39E-03; Z-score: 1.73E-01

Methylation in Case

 1.83E-01 (Median) Methylation in Control 1.78E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 5'UTR (cg01455178)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.43E-02; Z-score: 2.64E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 5'UTR (cg13791589)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.11E-02; Z-score: -1.04E-01

Methylation in Case

 2.97E-02 (Median) Methylation in Control 3.08E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 TSS1500 (cg17284384)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 5.52E-04; Z-score: 1.92E-01

Methylation in Case

 1.84E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC45A3 in systemic lupus erythematosus [ 12 ]

Location

 Body (cg14084826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.99E-02; Z-score: -1.85E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg23909013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.79E+00 Statistic Test p-value: 2.58E-04; Z-score: 3.48E+00

Methylation in Case

 3.39E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in colon adenocarcinoma [ 13 ]

Location

 TSS200 (cg00111823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.13E-03; Z-score: -1.41E+00

Methylation in Case

 9.41E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in colon adenocarcinoma [ 13 ]

Location

 TSS200 (cg19766441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.27E+00 Statistic Test p-value: 2.17E-03; Z-score: 2.22E+00

Methylation in Case

 2.60E-01 (Median) Methylation in Control 1.15E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in colon adenocarcinoma [ 13 ]

Location

 Body (cg15526153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.77E-04; Z-score: -2.05E+00

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in pancretic ductal adenocarcinoma [ 14 ]

Location

 TSS1500 (cg20982412)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 4.87E-20; Z-score: 4.79E+00

Methylation in Case

 4.20E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in pancretic ductal adenocarcinoma [ 14 ]

Location

 TSS1500 (cg13948585)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.89E+00 Statistic Test p-value: 8.15E-18; Z-score: 3.56E+00

Methylation in Case

 2.94E-01 (Median) Methylation in Control 1.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in pancretic ductal adenocarcinoma [ 14 ]

Location

 TSS200 (cg12005098)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.29E+00 Statistic Test p-value: 1.15E-21; Z-score: 3.76E+00

Methylation in Case

 1.43E-01 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in pancretic ductal adenocarcinoma [ 14 ]

Location

 Body (cg25253677)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.47E+00 Statistic Test p-value: 3.24E-09; Z-score: 1.33E+00

Methylation in Case

 1.59E-01 (Median) Methylation in Control 6.46E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC45A3 in pancretic ductal adenocarcinoma [ 14 ]

Location

 3'UTR (cg19877765)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.70E-02; Z-score: -1.06E+00

Methylation in Case

 4.39E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC45A3 in prostate cancer [ 15 ]

Location

 TSS1500 (cg05671585)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.69E+00 Statistic Test p-value: 9.42E-03; Z-score: 3.69E+00

Methylation in Case

 5.16E-02 (Median) Methylation in Control 3.04E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC45A3 in prostate cancer [ 15 ]

Location

 TSS200 (cg00881552)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.00E-03; Z-score: 3.77E+00

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.16E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC45A3 in prostate cancer [ 15 ]

Location

 TSS200 (cg21636683)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 7.27E-03; Z-score: 2.98E+00

Methylation in Case

 8.00E-01 (Median) Methylation in Control 6.00E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC45A3 in prostate cancer [ 15 ]

Location

 Body (cg21644011)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.40E-02; Z-score: 2.02E+00

Methylation in Case

 9.26E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-218 directly targets SLC45A3 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
15 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.