Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0372 Transporter Info
Gene Name	SLC46A1
Transporter Name	Proton-coupled folate transporter
Gene ID	113235
UniProt ID	Q96NT5

Epigenetic Regulations of This DT (EGR)
Methylation
Leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC46A1 in leukemia			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC46A1	Experiment Method	RT-qPCR
Studied Phenotype	Leukemia [ ICD-11: 2B33]
Experimental Material	Multiple cell lines of human
Additional Notes	SLC46A1 had increased methylation and decreased expression in pancreatic cancer.
Mesothelioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC46A1 in mesothelioma			[ 2 ]
Location	Promoter (-309 to 104 bp)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC46A1	Experiment Method	RT-qPCR
Studied Phenotype	Mesothelioma [ ICD-11: 2C26]
Experimental Material	Multiple cell lines of human
Additional Notes	Modulation of promoter methylation by 5-aza-2'-deoxycytidine may eradicate antifolate-resistant tumor cells displaying low SLC46A1 levels.
Cervical cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of SLC46A1 in cervical cancer (compare with antifolate-resistant counterpart cells)			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of SLC46A1	Experiment Method	RT-qPCR
Studied Phenotype	Cervical cancer [ ICD-11: 2C77.Z]
Experimental Material	Human cervical carcinoma cell line (Hela)
Additional Notes	Hypermethylation of the human proton-coupled folate transporter (SLC46A1) minimal transcriptional regulatory region in an antifolate-resistant HeLa cell line.
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	5'UTR (cg13765368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.93E+00	Statistic Test	p-value: 1.40E-02; Z-score: 1.17E+01
Methylation in Case	3.02E-01 (Median)	Methylation in Control	7.69E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	TSS1500 (cg23531340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.43E-02; Z-score: 1.48E+00
Methylation in Case	9.05E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	Body (cg26954464)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.29E-03; Z-score: 3.19E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	Body (cg02349468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 3.84E-03; Z-score: -2.94E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	5.99E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	Body (cg12589308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.12E-02; Z-score: 2.54E+00
Methylation in Case	9.50E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	Body (cg11017086)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 3.96E-02; Z-score: -2.48E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	3.91E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in prostate cancer			[ 4 ]
Location	3'UTR (cg15090262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.27E-03; Z-score: 3.53E+00
Methylation in Case	9.06E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	TSS1500 (cg27176697)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 9.04E-07; Z-score: -6.18E+00
Methylation in Case	4.95E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	TSS1500 (cg02062123)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 4.32E-05; Z-score: -3.85E+00
Methylation in Case	1.67E-01 (Median)	Methylation in Control	2.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	TSS1500 (cg22436928)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 3.53E-02; Z-score: -1.68E+00
Methylation in Case	6.58E-02 (Median)	Methylation in Control	9.08E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	TSS200 (cg23873654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.97E+00	Statistic Test	p-value: 3.30E-02; Z-score: -1.96E+00
Methylation in Case	1.35E-02 (Median)	Methylation in Control	2.67E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.37E-02; Z-score: -3.10E+00
Methylation in Case	4.64E-01 (Median)	Methylation in Control	5.59E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in bladder cancer			[ 5 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.65E-02; Z-score: -2.21E-01
Methylation in Case	7.40E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	TSS1500 (cg27176697)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.36E-13; Z-score: 1.56E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	TSS1500 (cg02062123)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 2.81E-09; Z-score: 3.04E+00
Methylation in Case	2.86E-01 (Median)	Methylation in Control	2.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg21732844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 3.38E-27; Z-score: 5.59E+00
Methylation in Case	6.33E-01 (Median)	Methylation in Control	4.06E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 7.23E-22; Z-score: 4.75E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	3.20E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 2.95E-20; Z-score: 3.54E+00
Methylation in Case	6.29E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 1.10E-12; Z-score: 2.43E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 8.75E-09; Z-score: 1.19E+00
Methylation in Case	5.06E-01 (Median)	Methylation in Control	3.75E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC46A1 in breast cancer			[ 6 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.84E-03; Z-score: -9.68E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg22436928)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.50E-02; Z-score: 7.02E-01
Methylation in Case	4.35E-02 (Median)	Methylation in Control	3.45E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg23873654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.74E-04; Z-score: 6.91E-01
Methylation in Case	1.60E-02 (Median)	Methylation in Control	1.47E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg10405239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 4.10E-03; Z-score: 4.79E-01
Methylation in Case	2.43E-02 (Median)	Methylation in Control	2.12E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.55E-02; Z-score: 1.29E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	4.92E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg02062123)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.56E-02; Z-score: 4.28E-01
Methylation in Case	2.39E-01 (Median)	Methylation in Control	2.24E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg10405239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.70E-02; Z-score: -3.72E-01
Methylation in Case	6.41E-02 (Median)	Methylation in Control	6.84E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	1stExon (cg15612845)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.64E-02; Z-score: -4.75E-01
Methylation in Case	3.44E-02 (Median)	Methylation in Control	3.91E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg20818262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.74E+00	Statistic Test	p-value: 2.59E-22; Z-score: -5.97E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg17343107)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 2.96E-17; Z-score: -3.42E+00
Methylation in Case	3.24E-01 (Median)	Methylation in Control	5.35E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg24585559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 5.53E-13; Z-score: -4.00E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 4.05E-10; Z-score: -1.88E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	6.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg09075844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.01E-09; Z-score: -1.80E+00
Methylation in Case	3.64E-01 (Median)	Methylation in Control	4.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg21732844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.36E-07; Z-score: -1.25E+00
Methylation in Case	3.92E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.74E-07; Z-score: -1.41E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	4.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 3.17E-07; Z-score: -1.33E+00
Methylation in Case	4.78E-01 (Median)	Methylation in Control	5.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 5.08E-07; Z-score: -1.52E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	4.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.61E-06; Z-score: -1.02E+00
Methylation in Case	3.85E-01 (Median)	Methylation in Control	4.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 7.14E-05; Z-score: 1.26E+00
Methylation in Case	7.56E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC46A1 in hepatocellular carcinoma			[ 8 ]
Location	3'UTR (cg05749559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.44E+00	Statistic Test	p-value: 3.82E-14; Z-score: -3.90E+00
Methylation in Case	4.41E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	TSS1500 (cg02062123)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.47E-04; Z-score: 1.21E+00
Methylation in Case	3.05E-01 (Median)	Methylation in Control	2.57E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	TSS1500 (cg22436928)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 4.22E-03; Z-score: 1.17E+00
Methylation in Case	1.17E-01 (Median)	Methylation in Control	9.58E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	TSS200 (cg23873654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 2.32E-03; Z-score: 9.52E-01
Methylation in Case	1.51E-02 (Median)	Methylation in Control	8.78E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	TSS200 (cg10405239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 3.34E-02; Z-score: 9.24E-01
Methylation in Case	7.14E-02 (Median)	Methylation in Control	5.94E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.25E-06; Z-score: -1.21E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	Body (cg21732844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 6.02E-03; Z-score: 3.99E-01
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 6.40E-03; Z-score: 8.64E-01
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 7.16E-03; Z-score: 7.82E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC46A1 in HIV infection			[ 9 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.76E-02; Z-score: 1.32E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg02062123)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 4.30E-02; Z-score: 1.14E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	1stExon (cg15612845)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 4.76E-02; Z-score: -8.26E-01
Methylation in Case	5.02E-02 (Median)	Methylation in Control	6.01E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.67E-03; Z-score: 1.86E+00
Methylation in Case	8.11E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 5.58E-03; Z-score: 1.76E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	6.18E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.42E-02; Z-score: 1.49E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.00E-02; Z-score: 1.68E+00
Methylation in Case	8.19E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg11754206)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.62E-04; Z-score: 4.29E-01
Methylation in Case	3.26E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in panic disorder			[ 12 ]
Location	TSS1500 (cg22436928)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.33E-01	Statistic Test	p-value: 1.66E-02; Z-score: -5.47E-01
Methylation in Case	-4.22E+00 (Median)	Methylation in Control	-3.93E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in panic disorder			[ 12 ]
Location	Body (cg21732844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.04E-02; Z-score: 1.56E-01
Methylation in Case	3.05E+00 (Median)	Methylation in Control	2.97E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	TSS1500 (cg22436928)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.86E-02; Z-score: -3.12E-01
Methylation in Case	7.04E-02 (Median)	Methylation in Control	7.51E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg10405239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 4.22E-03; Z-score: 6.22E-01
Methylation in Case	5.09E-02 (Median)	Methylation in Control	4.70E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg10923085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.17E-03; Z-score: -6.52E-01
Methylation in Case	5.33E-02 (Median)	Methylation in Control	5.90E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	1stExon (cg00497630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.57E-02; Z-score: 2.84E-01
Methylation in Case	8.74E-02 (Median)	Methylation in Control	8.49E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.08E-06; Z-score: 1.66E+00
Methylation in Case	6.10E-01 (Median)	Methylation in Control	5.43E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.63E-03; Z-score: -6.57E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 8.12E-03; Z-score: 6.67E-01
Methylation in Case	5.60E-01 (Median)	Methylation in Control	5.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	Body (cg21732977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.54E-03; Z-score: -6.51E-01
Methylation in Case	8.00E-02 (Median)	Methylation in Control	8.55E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC46A1 in papillary thyroid cancer			[ 13 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.98E-02; Z-score: 9.28E-01
Methylation in Case	6.75E-01 (Median)	Methylation in Control	6.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in colon adenocarcinoma			[ 14 ]
Location	TSS200 (cg26763542)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.62E-03; Z-score: -1.49E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	7.38E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in colon adenocarcinoma			[ 14 ]
Location	Body (cg07601645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.08E-05; Z-score: 1.53E+00
Methylation in Case	6.77E-01 (Median)	Methylation in Control	6.15E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in colon adenocarcinoma			[ 14 ]
Location	Body (cg13617811)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 6.64E-04; Z-score: -1.94E+00
Methylation in Case	2.56E-01 (Median)	Methylation in Control	3.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in colon adenocarcinoma			[ 14 ]
Location	Body (cg08094571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.21E-03; Z-score: -1.67E+00
Methylation in Case	3.37E-01 (Median)	Methylation in Control	3.80E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	TSS200 (cg10405239)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.81E-03; Z-score: 7.33E-01
Methylation in Case	9.52E-02 (Median)	Methylation in Control	8.79E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	1stExon (cg00497630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 4.67E-03; Z-score: 9.50E-01
Methylation in Case	1.10E-01 (Median)	Methylation in Control	9.76E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	1stExon (cg15612845)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.07E-02; Z-score: 1.19E-01
Methylation in Case	2.36E-02 (Median)	Methylation in Control	2.31E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 3.25E-10; Z-score: 2.61E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	Body (cg19822764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 7.22E-07; Z-score: 1.63E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	Body (cg21732844)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.70E-05; Z-score: 1.44E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.41E-04; Z-score: 1.09E+00
Methylation in Case	8.37E-01 (Median)	Methylation in Control	7.56E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC46A1 in colorectal cancer			[ 15 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 8.52E-04; Z-score: 7.71E-01
Methylation in Case	7.32E-01 (Median)	Methylation in Control	6.66E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in systemic lupus erythematosus			[ 16 ]
Location	TSS200 (cg23873654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.58E-03; Z-score: 6.84E-02
Methylation in Case	1.76E-02 (Median)	Methylation in Control	1.69E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg21732977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.03E-02; Z-score: 3.33E-01
Methylation in Case	2.98E-02 (Median)	Methylation in Control	2.58E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg25910803)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.82E-02; Z-score: -1.50E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.17E-02; Z-score: -2.21E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	1stExon (cg00497630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.85E+00	Statistic Test	p-value: 2.82E-34; Z-score: -5.11E+00
Methylation in Case	4.62E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	1stExon (cg15612845)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 2.85E-18; Z-score: -3.87E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	9.54E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	1stExon (cg25014117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 4.28E-16; Z-score: -2.20E+00
Methylation in Case	6.22E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	Body (cg04010423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 5.20E-04; Z-score: 6.30E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	Body (cg10762038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.77E-02; Z-score: 2.03E-01
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC46A1 in atypical teratoid rhabdoid tumor			[ 17 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.15E-02; Z-score: 6.18E-02
Methylation in Case	8.99E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
microRNA
B-cell acute lymphoblastic leukemia	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-595 downregulates SLC46A1 in B-cell acute lymphoblastic leukemia			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	In-silico analysis
Related Molecular Changes	Down regulation of SLC46A1	Experiment Method	Microarrays
miRNA Stemloop ID	miR-595	miRNA Mature ID	miR-595
miRNA Sequence	GAAGUGUGCCGUGGUGUGUCU
miRNA Target Type	Direct
Studied Phenotype	B-cell acute lymphoblastic leukemia [ ICD-11: 2A82]
Experimental Material	Patient tissue samples
Additional Notes	SNPs in miR-5189 that might affect SLC46A1 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
Epigenetic Phenomenon 2	miR-5189 downregulates SLC46A1 in B-cell acute lymphoblastic leukemia			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	In-silico analysis
miRNA Stemloop ID	miR-5189	miRNA Mature ID	miR-5189-5p
miRNA Sequence	UCUGGGCACAGGCGGAUGGACAGG
miRNA Target Type	Direct
Studied Phenotype	B-cell acute lymphoblastic leukemia [ ICD-11: 2A82]
Experimental Material	Patient tissue samples
Additional Notes	SNPs in miR-5189 that might affect SLC46A1 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
Unclear Phenotype	31 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1238 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1238	miRNA Mature ID	miR-1238-5p
miRNA Sequence	GUGAGUGGGAGCCCCAGUGUGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-130a directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-130a	miRNA Mature ID	miR-130a-3p
miRNA Sequence	CAGUGCAAUGUUAAAAGGGCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-130b directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-3p
miRNA Sequence	CAGUGCAAUGAUGAAAGGGCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 4	miR-138-1 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-138-1	miRNA Mature ID	miR-138-1-3p
miRNA Sequence	GCUACUUCACAACACCAGGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-18a directly targets SLC46A1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-18a	miRNA Mature ID	miR-18a-3p
miRNA Sequence	ACUGCCCUAAGUGCUCCUUCUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-1909 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1909	miRNA Mature ID	miR-1909-5p
miRNA Sequence	UGAGUGCCGGUGCCUGCCCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-19a directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-3p
miRNA Sequence	UGUGCAAAUCUAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	miR-19b directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19b	miRNA Mature ID	miR-19b-3p
miRNA Sequence	UGUGCAAAUCCAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-301a directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-301a	miRNA Mature ID	miR-301a-3p
miRNA Sequence	CAGUGCAAUAGUAUUGUCAAAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-301b directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-301b	miRNA Mature ID	miR-301b-3p
miRNA Sequence	CAGUGCAAUGAUAUUGUCAAAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 11	miR-3666 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3666	miRNA Mature ID	miR-3666
miRNA Sequence	CAGUGCAAGUGUAGAUGCCGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-3682 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3682	miRNA Mature ID	miR-3682-5p
miRNA Sequence	CUACUUCUACCUGUGUUAUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4295 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4295	miRNA Mature ID	miR-4295
miRNA Sequence	CAGUGCAAUGUUUUCCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 14	miR-449b directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-449b	miRNA Mature ID	miR-449b-3p
miRNA Sequence	CAGCCACAACUACCCUGCCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 15	miR-4511 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4511	miRNA Mature ID	miR-4511
miRNA Sequence	GAAGAACUGUUGCAUUUGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-454 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-454	miRNA Mature ID	miR-454-3p
miRNA Sequence	UAGUGCAAUAUUGCUUAUAGGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-4658 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4658	miRNA Mature ID	miR-4658
miRNA Sequence	GUGAGUGUGGAUCCUGGAGGAAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-4713 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4713	miRNA Mature ID	miR-4713-5p
miRNA Sequence	UUCUCCCACUACCAGGCUCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4758 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4758	miRNA Mature ID	miR-4758-5p
miRNA Sequence	GUGAGUGGGAGCCGGUGGGGCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-518a directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-518a	miRNA Mature ID	miR-518a-5p
miRNA Sequence	CUGCAAAGGGAAGCCCUUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 21	miR-527 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-527	miRNA Mature ID	miR-527
miRNA Sequence	CUGCAAAGGGAAGCCCUUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-561 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-561	miRNA Mature ID	miR-561-3p
miRNA Sequence	CAAAGUUUAAGAUCCUUGAAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-580 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-580	miRNA Mature ID	miR-580-3p
miRNA Sequence	UUGAGAAUGAUGAAUCAUUAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-629 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-629	miRNA Mature ID	miR-629-3p
miRNA Sequence	GUUCUCCCAACGUAAGCCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-6790 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6790	miRNA Mature ID	miR-6790-5p
miRNA Sequence	GUGAGUGUGGAUUUGGCGGGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 26	miR-6793 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6793	miRNA Mature ID	miR-6793-3p
miRNA Sequence	UCCCCAACCCCUGCCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-6814 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6814	miRNA Mature ID	miR-6814-5p
miRNA Sequence	UCCCAAGGGUGAGAUGCUGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-6844 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6844	miRNA Mature ID	miR-6844
miRNA Sequence	UUCUUUGUUUUUAAUUCACAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-6867 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-3p
miRNA Sequence	CUCUCCCUCUUUACCCACUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-6895 directly targets SLC46A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6895	miRNA Mature ID	miR-6895-5p
miRNA Sequence	CAGGGCCAGGCACAGAGUAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-8081 directly targets SLC46A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8081	miRNA Mature ID	miR-8081
miRNA Sequence	CUUGAGUCGUGCCUUUCUGAAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells. Biochem Biophys Res Commun. 2008 Nov 28;376(4):787-92.
2	Role of proton-coupled folate transporter in pemetrexed resistance of mesothelioma: clinical evidence and new pharmacological tools. Ann Oncol. 2017 Nov 1;28(11):2725-2732.
3	Hypermethylation of the human proton-coupled folate transporter (SLC46A1) minimal transcriptional regulatory region in an antifolate-resistant HeLa cell line. Mol Cancer Ther. 2009 Aug;8(8):2424-31.
4	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
5	DNA Methylation Dynamics in Urological Tumors.
6	Genome-wide Scan for Methylation Profiles in Breast Cancer
7	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
16	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
18	MiR-pharmacogenetics of methotrexate in childhood B-cell acute lymphoblastic leukemia. Pharmacogenet Genomics. 2016 Nov;26(11):517-525.
19	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
20	The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
21	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence