Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0375 Transporter Info
Gene Name SLC48A1
Transporter Name Heme transporter HRG1
Gene ID
55652
UniProt ID
Q6P1K1
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in breast cancer [ 1 ]

Location

 TSS200 (cg01379969)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.27E-02; Z-score: 2.72E-01

Methylation in Case

 8.04E-02 (Median) Methylation in Control 7.48E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in breast cancer [ 1 ]

Location

 Body (cg12391174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 3.12E-03; Z-score: -6.42E-01

Methylation in Case

 5.86E-02 (Median) Methylation in Control 6.92E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS200 (cg15295332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.65E-04; Z-score: -7.31E-01

Methylation in Case

 3.94E-02 (Median) Methylation in Control 4.21E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

 TSS200 (cg15295332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 3.08E-02; Z-score: -7.89E-01

Methylation in Case

 4.68E-02 (Median) Methylation in Control 6.25E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 3.78E-09; Z-score: -1.96E+00

Methylation in Case

 3.27E-01 (Median) Methylation in Control 5.36E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

 Body (cg06946447)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 7.70E-03; Z-score: -4.48E-01

Methylation in Case

 1.40E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.91E-02; Z-score: -4.37E-01

Methylation in Case

 9.22E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in HIV infection [ 4 ]

Location

 TSS200 (cg01379969)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.92E-02; Z-score: -3.69E-01

Methylation in Case

 9.17E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in HIV infection [ 4 ]

Location

 Body (cg16170936)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.71E+00 Statistic Test p-value: 3.81E-08; Z-score: 3.05E+00

Methylation in Case

 3.71E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC48A1 in HIV infection [ 4 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.02E-03; Z-score: 9.92E-01

Methylation in Case

 1.96E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC48A1 in HIV infection [ 4 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.54E-03; Z-score: -9.41E-01

Methylation in Case

 9.12E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in lung adenocarcinoma [ 5 ]

Location

 TSS200 (cg15295332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.39E-02; Z-score: 1.52E+00

Methylation in Case

 5.63E-02 (Median) Methylation in Control 4.01E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in lung adenocarcinoma [ 5 ]

Location

 Body (cg16170936)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 8.53E-03; Z-score: 3.00E+00

Methylation in Case

 3.04E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 1stExon (cg15012572)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.55E+00 Statistic Test p-value: 1.06E-18; Z-score: -2.98E+00

Methylation in Case

 2.37E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg01154392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 4.83E-05; Z-score: 1.20E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg05936305)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.86E-03; Z-score: -7.53E-01

Methylation in Case

 6.47E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg06946447)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.14E-03; Z-score: 2.82E-01

Methylation in Case

 9.04E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg12391174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.71E-02; Z-score: 6.32E-01

Methylation in Case

 6.65E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.76E-02; Z-score: 7.97E-01

Methylation in Case

 7.72E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 4.97E-11; Z-score: 1.90E+00

Methylation in Case

 7.33E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in systemic lupus erythematosus [ 7 ]

Location

 1stExon (cg15012572)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.14E-02; Z-score: 1.52E-01

Methylation in Case

 2.03E-02 (Median) Methylation in Control 1.93E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in systemic lupus erythematosus [ 7 ]

Location

 Body (cg06946447)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.78E-03; Z-score: -1.31E-01

Methylation in Case

 1.05E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

 Body (cg16170936)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.03E+00 Statistic Test p-value: 4.02E-03; Z-score: -3.23E+00

Methylation in Case

 1.03E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

 Body (cg05936305)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 2.05E-02; Z-score: 1.80E+00

Methylation in Case

 3.54E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 2.73E-02; Z-score: 2.39E+00

Methylation in Case

 2.99E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 9.11E-04; Z-score: -2.58E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in colon adenocarcinoma [ 9 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 8.65E-05; Z-score: 2.88E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in depression [ 10 ]

Location

 Body (cg01154392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.63E-02; Z-score: -3.48E-01

Methylation in Case

 3.67E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg09058554)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.67E+00 Statistic Test p-value: 9.68E-16; Z-score: -2.95E+00

Methylation in Case

 3.69E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg21602614)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 3.48E-14; Z-score: -3.44E+00

Methylation in Case

 2.23E-01 (Median) Methylation in Control 3.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.41E-04; Z-score: -1.06E+00

Methylation in Case

 2.83E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

 Body (cg16170936)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 1.35E-03; Z-score: -1.13E+00

Methylation in Case

 1.68E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.05E-02; Z-score: 1.95E-02

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg19854293)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.12E-04; Z-score: 7.61E-01

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in pancretic ductal adenocarcinoma [ 12 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.41E-02; Z-score: -2.96E-01

Methylation in Case

 7.54E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC48A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 4.69E-12; Z-score: -1.94E+00

Methylation in Case

 1.55E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC48A1 in papillary thyroid cancer [ 13 ]

Location

 3'UTR (cg14736327)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.57E-05; Z-score: -9.34E-01

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-10b directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

 UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1245b directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1245b miRNA Mature ID miR-1245b-3p

miRNA Sequence

 UCAGAUGAUCUAAAGGCCUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1468 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1468 miRNA Mature ID miR-1468-3p

miRNA Sequence

 AGCAAAAUAAGCAAAUGGAAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-192 directly targets SLC48A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1973 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1973 miRNA Mature ID miR-1973

miRNA Sequence

 ACCGUGCAAAGGUAGCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-19a directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

 UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-19b directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-215 directly targets SLC48A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-3175 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3175 miRNA Mature ID miR-3175

miRNA Sequence

 CGGGGAGAGAACGCAGUGACGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3179 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3179 miRNA Mature ID miR-3179

miRNA Sequence

 AGAAGGGGUGAAAUUUAAACGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-3190 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3190 miRNA Mature ID miR-3190-5p

miRNA Sequence

 UCUGGCCAGCUACGUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3202 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3202 miRNA Mature ID miR-3202

miRNA Sequence

 UGGAAGGGAGAAGAGCUUUAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-339 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

 UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-3926 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

 UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-423 directly targets SLC48A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

 UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-4421 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4421 miRNA Mature ID miR-4421

miRNA Sequence

 ACCUGUCUGUGGAAAGGAGCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4470 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4470 miRNA Mature ID miR-4470

miRNA Sequence

 UGGCAAACGUGGAAGCCGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4684 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

 CUCUCUACUGACUUGCAACAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-4698 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4698 miRNA Mature ID miR-4698

miRNA Sequence

 UCAAAAUGUAGAGGAAGACCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4716 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4716 miRNA Mature ID miR-4716-3p

miRNA Sequence

 AAGGGGGAAGGAAACAUGGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-4723 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

 UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-4747 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4747 miRNA Mature ID miR-4747-5p

miRNA Sequence

 AGGGAAGGAGGCUUGGUCUUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4786 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4786 miRNA Mature ID miR-4786-5p

miRNA Sequence

 UGAGACCAGGACUGGAUGCACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-5196 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5196 miRNA Mature ID miR-5196-5p

miRNA Sequence

 AGGGAAGGGGACGAGGGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-548aj directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aj miRNA Mature ID miR-548aj-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-548aw directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aw miRNA Mature ID miR-548aw

miRNA Sequence

 GUGCAAAAGUCAUCACGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-548f directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548f miRNA Mature ID miR-548f-5p

miRNA Sequence

 UGCAAAAGUAAUCACAGUUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-548g directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548g miRNA Mature ID miR-548g-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-548s directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548s miRNA Mature ID miR-548s

miRNA Sequence

 AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-548x directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548x miRNA Mature ID miR-548x-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-5698 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

 UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-5699 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5699 miRNA Mature ID miR-5699-3p

miRNA Sequence

 UCCUGUCUUUCCUUGUUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-593 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-593 miRNA Mature ID miR-593-3p

miRNA Sequence

 UGUCUCUGCUGGGGUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-6732 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6732 miRNA Mature ID miR-6732-3p

miRNA Sequence

 UAACCCUGUCCUCUCCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-6794 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6794 miRNA Mature ID miR-6794-5p

miRNA Sequence

 CAGGGGGACUGGGGGUGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-6818 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6818 miRNA Mature ID miR-6818-3p

miRNA Sequence

 UUGUCUCUUGUUCCUCACACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-6849 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-6870 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

 UGGGGGAGAUGGGGGUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-6895 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6895 miRNA Mature ID miR-6895-3p

miRNA Sequence

 UGUCUCUCGCCCUUGGCCUUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-7111 directly targets SLC48A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

 UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-877 directly targets SLC48A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

 UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 43

 miR-942 directly targets SLC48A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-942 miRNA Mature ID miR-942-3p

miRNA Sequence

 CACAUGGCCGAAACAGAGAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 DNA Methylation Dynamics in Urological Tumors.
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
15 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
16 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.