Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0380 Transporter Info
Gene Name	SLC4A1
Transporter Name	Anion exchange protein 1
Gene ID	6521
UniProt ID	P02730

Epigenetic Regulations of This DT (EGR)
Methylation
Breast cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	5'UTR (cg02998129)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 9.72E-03; Z-score: 4.35E-01
Methylation in Case	7.96E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 1.97E-23; Z-score: -4.18E+00
Methylation in Case	4.50E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	TSS1500 (cg16464328)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 3.28E-11; Z-score: -1.65E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	TSS200 (cg24607642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 4.91E-15; Z-score: -3.06E+00
Methylation in Case	5.10E-01 (Median)	Methylation in Control	7.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	TSS200 (cg23728471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.13E-07; Z-score: -1.51E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC4A1 in breast cancer			[ 1 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 3.12E-13; Z-score: -2.06E+00
Methylation in Case	5.41E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in lung adenocarcinoma			[ 2 ]
Location	5'UTR (cg02998129)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 7.59E-06; Z-score: 4.21E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in lung adenocarcinoma			[ 2 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 3.06E-02; Z-score: -1.58E+00
Methylation in Case	5.97E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in pancretic ductal adenocarcinoma			[ 3 ]
Location	5'UTR (cg21252914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.70E+00	Statistic Test	p-value: 1.76E-17; Z-score: 2.51E+00
Methylation in Case	1.50E-01 (Median)	Methylation in Control	8.83E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg14453449)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.99E-03; Z-score: 1.06E+00
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in pancretic ductal adenocarcinoma			[ 3 ]
Location	Body (cg03612649)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.57E-02; Z-score: -5.79E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in papillary thyroid cancer			[ 4 ]
Location	5'UTR (cg02998129)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.47E-10; Z-score: 1.71E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in papillary thyroid cancer			[ 4 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.51E-03; Z-score: -5.06E-01
Methylation in Case	7.38E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in papillary thyroid cancer			[ 4 ]
Location	TSS200 (cg23728471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.62E-03; Z-score: -7.30E-01
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in papillary thyroid cancer			[ 4 ]
Location	TSS200 (cg24607642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.00E-03; Z-score: -1.70E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.49E+00	Statistic Test	p-value: 1.53E-13; Z-score: -1.87E+01
Methylation in Case	2.10E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	TSS1500 (cg16464328)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 3.13E-10; Z-score: -1.23E+01
Methylation in Case	4.10E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	TSS200 (cg23728471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 1.08E-07; Z-score: -8.65E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	TSS200 (cg24607642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.05E+00	Statistic Test	p-value: 3.20E-06; Z-score: -5.37E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	4.11E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 7.77E-06; Z-score: -6.94E+00
Methylation in Case	3.85E-01 (Median)	Methylation in Control	5.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC4A1 in bladder cancer			[ 5 ]
Location	3'UTR (cg02892423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.98E-05; Z-score: -7.15E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg16464328)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.49E-02; Z-score: -5.35E-01
Methylation in Case	6.83E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.37E-02; Z-score: -5.24E-01
Methylation in Case	5.18E-01 (Median)	Methylation in Control	5.71E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg24607642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 6.68E-07; Z-score: -1.96E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg23728471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.36E-05; Z-score: -1.20E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.60E+00	Statistic Test	p-value: 1.33E-13; Z-score: -3.37E+00
Methylation in Case	4.17E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC4A1 in colorectal cancer			[ 6 ]
Location	3'UTR (cg02892423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.02E-04; Z-score: -1.05E+00
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg05862393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 1.89E-11; Z-score: -1.92E+00
Methylation in Case	6.28E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg23728471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.56E-07; Z-score: -2.11E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg24607642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.00E-03; Z-score: -5.01E-01
Methylation in Case	6.63E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.04E-09; Z-score: -2.13E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC4A1 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg02892423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 9.26E-05; Z-score: -7.89E-01
Methylation in Case	7.16E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Prostate cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in prostate cancer			[ 8 ]
Location	TSS200 (cg00868652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 2.71E-03; Z-score: 3.79E+00
Methylation in Case	8.24E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC4A1 in prostate cancer			[ 8 ]
Location	Body (cg08351607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 8.78E-03; Z-score: 2.80E+00
Methylation in Case	8.97E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC4A1 in prostate cancer			[ 8 ]
Location	Body (cg27576259)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.24E-02; Z-score: -2.86E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	5.35E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC4A1 in prostate cancer			[ 8 ]
Location	Body (cg22566355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.02E-02; Z-score: 1.59E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC4A1 in panic disorder			[ 9 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.22E-01	Statistic Test	p-value: 3.59E-02; Z-score: -3.26E-01
Methylation in Case	-2.27E+00 (Median)	Methylation in Control	-2.09E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC4A1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.60E-07; Fold-change: -0.281820038; Z-score: -2.114948546
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC4A1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.74E-23; Fold-change: -0.627280216; Z-score: -5.745036708
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC4A1 in lung cancer than that in other disease section
Studied Phenotype	Lung cancer [ICD-11:2C25]
The Methylation Level of Disease Section Compare with the Other Disease Section	p-value: .; Fold-change: .; Z-score: .
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	59 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-105 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-105	miRNA Mature ID	miR-105-5p
miRNA Sequence	UCAAAUGCUCAGACUCCUGUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1182 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1182	miRNA Mature ID	miR-1182
miRNA Sequence	GAGGGUCUUGGGAGGGAUGUGAC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 3	miR-122 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 4	miR-1224 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1224	miRNA Mature ID	miR-1224-3p
miRNA Sequence	CCCCACCUCCUCUCUCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-1244 directly targets SLC4A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1244	miRNA Mature ID	miR-1244
miRNA Sequence	AAGUAGUUGGUUUGUAUGAGAUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-1267 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1267	miRNA Mature ID	miR-1267
miRNA Sequence	CCUGUUGAAGUGUAAUCCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-129 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 8	miR-1306 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1306	miRNA Mature ID	miR-1306-5p
miRNA Sequence	CCACCUCCCCUGCAAACGUCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-130b directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-5p
miRNA Sequence	ACUCUUUCCCUGUUGCACUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-143 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-5p
miRNA Sequence	GGUGCAGUGCUGCAUCUCUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 11	miR-193b directly targets SLC4A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-193b	miRNA Mature ID	miR-193b-5p
miRNA Sequence	CGGGGUUUUGAGGGCGAGAUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-197 directly targets SLC4A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-197	miRNA Mature ID	miR-197-3p
miRNA Sequence	UUCACCACCUUCUCCACCCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-3135b directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3135b	miRNA Mature ID	miR-3135b
miRNA Sequence	GGCUGGAGCGAGUGCAGUGGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 14	miR-3183 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3183	miRNA Mature ID	miR-3183
miRNA Sequence	GCCUCUCUCGGAGUCGCUCGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-3187 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3187	miRNA Mature ID	miR-3187-3p
miRNA Sequence	UUGGCCAUGGGGCUGCGCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-3652 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3652	miRNA Mature ID	miR-3652
miRNA Sequence	CGGCUGGAGGUGUGAGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-3663 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3663	miRNA Mature ID	miR-3663-5p
miRNA Sequence	GCUGGUCUGCGUGGUGCUCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-367 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-367	miRNA Mature ID	miR-367-5p
miRNA Sequence	ACUGUUGCUAAUAUGCAACUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-3672 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3672	miRNA Mature ID	miR-3672
miRNA Sequence	AUGAGACUCAUGUAAAACAUCUU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 20	miR-371a directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-371a	miRNA Mature ID	miR-371a-5p
miRNA Sequence	ACUCAAACUGUGGGGGCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-371b directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-371b	miRNA Mature ID	miR-371b-5p
miRNA Sequence	ACUCAAAAGAUGGCGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-372 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-5p
miRNA Sequence	CCUCAAAUGUGGAGCACUAUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-373 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-5p
miRNA Sequence	ACUCAAAAUGGGGGCGCUUUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-378a directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-378a	miRNA Mature ID	miR-378a-5p
miRNA Sequence	CUCCUGACUCCAGGUCCUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-4423 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4423	miRNA Mature ID	miR-4423-5p
miRNA Sequence	AGUUGCCUUUUUGUUCCCAUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 26	miR-4430 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4430	miRNA Mature ID	miR-4430
miRNA Sequence	AGGCUGGAGUGAGCGGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 27	miR-4435 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4435	miRNA Mature ID	miR-4435
miRNA Sequence	AUGGCCAGAGCUCACACAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-4454 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4454	miRNA Mature ID	miR-4454
miRNA Sequence	GGAUCCGAGUCACGGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-4524a directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4524a	miRNA Mature ID	miR-4524a-3p
miRNA Sequence	UGAGACAGGCUUAUGCUGCUAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 30	miR-4524b directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4524b	miRNA Mature ID	miR-4524b-3p
miRNA Sequence	GAGACAGGUUCAUGCUGCUA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 31	miR-4691 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4691	miRNA Mature ID	miR-4691-3p
miRNA Sequence	CCAGCCACGGACUGAGAGUGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-4701 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4701	miRNA Mature ID	miR-4701-5p
miRNA Sequence	UUGGCCACCACACCUACCCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-4716 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4716	miRNA Mature ID	miR-4716-5p
miRNA Sequence	UCCAUGUUUCCUUCCCCCUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-4723 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4723	miRNA Mature ID	miR-4723-3p
miRNA Sequence	CCCUCUCUGGCUCCUCCCCAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-4753 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4753	miRNA Mature ID	miR-4753-3p
miRNA Sequence	UUCUCUUUCUUUAGCCUUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-4755 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-3p
miRNA Sequence	AGCCAGGCUCUGAAGGGAAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-4781 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4781	miRNA Mature ID	miR-4781-3p
miRNA Sequence	AAUGUUGGAAUCCUCGCUAGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-504 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-504	miRNA Mature ID	miR-504-3p
miRNA Sequence	GGGAGUGCAGGGCAGGGUUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 39	miR-5193 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5193	miRNA Mature ID	miR-5193
miRNA Sequence	UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-548s directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-5698 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 42	miR-588 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-588	miRNA Mature ID	miR-588
miRNA Sequence	UUGGCCACAAUGGGUUAGAAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-6131 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6131	miRNA Mature ID	miR-6131
miRNA Sequence	GGCUGGUCAGAUGGGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-616 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-616	miRNA Mature ID	miR-616-5p
miRNA Sequence	ACUCAAAACCCUUCAGUGACUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-6499 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 46	miR-6501 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6501	miRNA Mature ID	miR-6501-5p
miRNA Sequence	AGUUGCCAGGGCUGCCUUUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-6727 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6727	miRNA Mature ID	miR-6727-3p
miRNA Sequence	UCCUGCCACCUCCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 48	miR-6769b directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6769b	miRNA Mature ID	miR-6769b-3p
miRNA Sequence	CCCUCUCUGUCCCACCCAUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 49	miR-6790 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6790	miRNA Mature ID	miR-6790-3p
miRNA Sequence	CGACCUCGGCGACCCCUCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 50	miR-6812 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6812	miRNA Mature ID	miR-6812-3p
miRNA Sequence	CCGCUCUUCCCCUGACCCCAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 51	miR-6821 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6821	miRNA Mature ID	miR-6821-3p
miRNA Sequence	UGACCUCUCCGCUCCGCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-6843 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6843	miRNA Mature ID	miR-6843-3p
miRNA Sequence	AUGGUCUCCUGUUCUCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 53	miR-6848 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6848	miRNA Mature ID	miR-6848-3p
miRNA Sequence	GUGGUCUCUUGGCCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 54	miR-6864 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6864	miRNA Mature ID	miR-6864-3p
miRNA Sequence	GUGAGACUUCUCUCCCUUCAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 55	miR-7111 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-3p
miRNA Sequence	AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 56	miR-744 directly targets SLC4A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-744	miRNA Mature ID	miR-744-3p
miRNA Sequence	CUGUUGCCACUAACCUCAACCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 57	miR-7853 directly targets SLC4A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7853	miRNA Mature ID	miR-7853-5p
miRNA Sequence	UCAAAUGCAGAUCCUGACUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 58	miR-802 directly targets SLC4A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-802	miRNA Mature ID	miR-802
miRNA Sequence	CAGUAACAAAGAUUCAUCCUUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 59	miR-8055 directly targets SLC4A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8055	miRNA Mature ID	miR-8055
miRNA Sequence	CUUUGAGCACAUGAGCAGACGGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human

References
1	Genome-wide Scan for Methylation Profiles in Breast Cancer
2	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
3	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5	DNA Methylation Dynamics in Urological Tumors.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
11	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
12	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
13	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence