Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0383 Transporter Info
Gene Name SLC4A2
Transporter Name Anion exchange protein 2
Gene ID
6522
UniProt ID
P04920
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.38E-07; Z-score: -1.42E+00

Methylation in Case

 5.93E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10920230)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.96E-07; Z-score: -1.12E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13145017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 4.89E-07; Z-score: -1.21E+00

Methylation in Case

 3.44E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg01971363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 1.07E-04; Z-score: 1.13E+00

Methylation in Case

 7.99E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg03426615)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.44E-04; Z-score: -5.97E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg04824535)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 9.65E-04; Z-score: -6.52E-01

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg06018240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 2.06E-03; Z-score: 1.13E+00

Methylation in Case

 6.44E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg02367856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.75E-15; Z-score: -2.58E+00

Methylation in Case

 7.29E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg15387987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 5.92E-11; Z-score: -1.80E+00

Methylation in Case

 1.39E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC4A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg24316073)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.33E-09; Z-score: -1.60E+00

Methylation in Case

 6.44E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 8.16E-12; Z-score: 1.35E+01

Methylation in Case

 7.31E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg22151713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 7.01E-08; Z-score: 1.29E+01

Methylation in Case

 8.02E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg06018240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 8.83E-08; Z-score: 7.18E+00

Methylation in Case

 8.13E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg19502841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.13E-05; Z-score: 4.17E+00

Methylation in Case

 7.29E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg01971363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.60E-03; Z-score: 2.86E+00

Methylation in Case

 9.32E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg17497176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 4.11E-03; Z-score: 1.68E+00

Methylation in Case

 7.44E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg20898078)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.50E-02; Z-score: 1.40E+00

Methylation in Case

 9.69E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC4A2 in bladder cancer [ 2 ]

Location

 Body (cg18955629)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.21E-02; Z-score: 2.77E+00

Methylation in Case

 6.05E-01 (Median) Methylation in Control 4.93E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 5'UTR (cg13145017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 6.00E-03; Z-score: 6.85E-01

Methylation in Case

 4.01E-02 (Median) Methylation in Control 3.12E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.21E-02; Z-score: 1.05E+00

Methylation in Case

 6.94E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 5'UTR (cg10920230)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.65E-02; Z-score: 2.21E-01

Methylation in Case

 1.61E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg17497176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.03E-20; Z-score: 2.57E+00

Methylation in Case

 7.58E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg19502841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.39E-10; Z-score: 1.51E+00

Methylation in Case

 7.54E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg03426615)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 6.26E-10; Z-score: 1.43E+00

Methylation in Case

 9.00E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg22168987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.14E-07; Z-score: -1.29E+00

Methylation in Case

 6.59E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg06018240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.28E-06; Z-score: 1.12E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg18955629)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.52E-03; Z-score: 1.08E+00

Methylation in Case

 4.88E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC4A2 in breast cancer [ 3 ]

Location

 Body (cg20898078)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 6.74E-03; Z-score: 4.45E-01

Methylation in Case

 9.62E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 4.60E-06; Z-score: 2.71E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg13145017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.05E-02; Z-score: -5.61E-01

Methylation in Case

 2.83E-02 (Median) Methylation in Control 3.02E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg22168987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.36E-03; Z-score: -1.76E+00

Methylation in Case

 5.95E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 5'UTR (cg13145017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 4.71E-03; Z-score: -6.93E-01

Methylation in Case

 3.94E-02 (Median) Methylation in Control 4.56E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 Body (cg25903588)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.47E-03; Z-score: 7.18E-01

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 Body (cg03426615)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.12E-02; Z-score: -2.68E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 Body (cg04824535)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.48E-02; Z-score: 1.64E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 3'UTR (cg15387987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.29E-08; Z-score: -2.09E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 3'UTR (cg02367856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.41E-04; Z-score: -9.08E-01

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in colorectal cancer [ 5 ]

Location

 3'UTR (cg24316073)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.61E-03; Z-score: -5.28E-01

Methylation in Case

 9.11E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg10842164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.94E-04; Z-score: -6.94E-01

Methylation in Case

 6.98E-01 (Median) Methylation in Control 7.19E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg20122849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 4.07E-15; Z-score: -7.11E+00

Methylation in Case

 5.45E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg22151713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 1.15E-08; Z-score: -1.44E+00

Methylation in Case

 3.95E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg03426615)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.44E-02; Z-score: -3.15E-01

Methylation in Case

 9.23E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg15387987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.25E-04; Z-score: -7.32E-01

Methylation in Case

 7.63E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg02367856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.18E-03; Z-score: -3.48E-01

Methylation in Case

 8.57E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg13145017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.38E-02; Z-score: -5.06E-01

Methylation in Case

 8.81E-02 (Median) Methylation in Control 9.32E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg18955629)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 7.04E-14; Z-score: -4.22E+00

Methylation in Case

 5.95E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg17497176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 9.51E-07; Z-score: 1.40E+00

Methylation in Case

 8.46E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg01971363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.48E-04; Z-score: -8.53E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg22151713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.74E-03; Z-score: 8.79E-01

Methylation in Case

 7.23E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg20898078)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.61E-03; Z-score: 6.30E-01

Methylation in Case

 9.39E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg04824535)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.10E-02; Z-score: -6.71E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC4A2 in papillary thyroid cancer [ 7 ]

Location

 3'UTR (cg15387987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.14E-04; Z-score: 1.64E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in colon adenocarcinoma [ 8 ]

Location

 TSS1500 (cg11742202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 3.00E-03; Z-score: -1.76E+00

Methylation in Case

 1.41E-01 (Median) Methylation in Control 2.24E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in colon adenocarcinoma [ 8 ]

Location

 Body (cg13889508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 4.02E-06; Z-score: -4.18E+00

Methylation in Case

 7.16E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in colon adenocarcinoma [ 8 ]

Location

 Body (cg08792812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 6.87E-04; Z-score: -1.76E+00

Methylation in Case

 3.60E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg27036111)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.28E-10; Z-score: 1.81E+00

Methylation in Case

 5.41E-01 (Median) Methylation in Control 4.20E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg12133118)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 1.08E-03; Z-score: 9.90E-01

Methylation in Case

 5.96E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg06288351)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 1.75E-14; Z-score: -2.37E+00

Methylation in Case

 2.36E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg22165524)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.97E-04; Z-score: 1.06E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg15523980)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.25E-03; Z-score: -4.16E-01

Methylation in Case

 8.91E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg08411738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.67E-03; Z-score: 8.89E-01

Methylation in Case

 8.50E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC4A2 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg12583394)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.27E-02; Z-score: 7.18E-02

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in prostate cancer [ 10 ]

Location

 TSS1500 (cg10678459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 2.84E-02; Z-score: 1.85E+00

Methylation in Case

 7.67E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in prostate cancer [ 10 ]

Location

 Body (cg02295574)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.72E-03; Z-score: 6.35E+00

Methylation in Case

 9.41E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in prostate cancer [ 10 ]

Location

 Body (cg08450807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.64E-02; Z-score: -7.72E+00

Methylation in Case

 7.64E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in HIV infection [ 11 ]

Location

 Body (cg03426615)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.33E-09; Z-score: 1.67E+00

Methylation in Case

 9.54E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A2 in HIV infection [ 11 ]

Location

 Body (cg17497176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 8.81E-05; Z-score: 7.16E-01

Methylation in Case

 8.88E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A2 in HIV infection [ 11 ]

Location

 Body (cg18955629)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.04E-02; Z-score: 5.04E-01

Methylation in Case

 9.03E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A2 in HIV infection [ 11 ]

Location

 Body (cg01971363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 1.46E-02; Z-score: 4.32E-01

Methylation in Case

 9.65E-01 (Median) Methylation in Control 9.61E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A2 in lung adenocarcinoma [ 12 ]

Location

 Body (cg25903588)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.04E-02; Z-score: 8.93E-01

Methylation in Case

 9.21E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          48 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1205 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1205 miRNA Mature ID miR-1205

miRNA Sequence

 UCUGCAGGGUUUGCUUUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1253 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1253 miRNA Mature ID miR-1253

miRNA Sequence

 AGAGAAGAAGAUCAGCCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1275 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1275 miRNA Mature ID miR-1275

miRNA Sequence

 GUGGGGGAGAGGCUGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1296 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1296 miRNA Mature ID miR-1296-3p

miRNA Sequence

 GAGUGGGGCUUCGACCCUAACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-16 directly targets SLC4A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-1909 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1909 miRNA Mature ID miR-1909-3p

miRNA Sequence

 CGCAGGGGCCGGGUGCUCACCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-194 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-194 miRNA Mature ID miR-194-3p

miRNA Sequence

 CCAGUGGGGCUGCUGUUAUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3150b directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

 UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-330 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

 GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-34a directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

 UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-34c directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-34c miRNA Mature ID miR-34c-5p

miRNA Sequence

 AGGCAGUGUAGUUAGCUGAUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-3926 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

 UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4418 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4418 miRNA Mature ID miR-4418

miRNA Sequence

 CACUGCAGGACUCAGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4434 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4434 miRNA Mature ID miR-4434

miRNA Sequence

 AGGAGAAGUAAAGUAGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4447 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4447 miRNA Mature ID miR-4447

miRNA Sequence

 GGUGGGGGCUGUUGUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4472 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4472 miRNA Mature ID miR-4472

miRNA Sequence

 GGUGGGGGGUGUUGUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-449a directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-449a miRNA Mature ID miR-449a

miRNA Sequence

 UGGCAGUGUAUUGUUAGCUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-449b directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-449b miRNA Mature ID miR-449b-5p

miRNA Sequence

 AGGCAGUGUAUUGUUAGCUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4516 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4516 miRNA Mature ID miR-4516

miRNA Sequence

 GGGAGAAGGGUCGGGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-4525 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4525 miRNA Mature ID miR-4525

miRNA Sequence

 GGGGGGAUGUGCAUGCUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-455 directly targets SLC4A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

 GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-4665 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4665 miRNA Mature ID miR-4665-5p

miRNA Sequence

 CUGGGGGACGCGUGAGCGCGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-4688 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4688 miRNA Mature ID miR-4688

miRNA Sequence

 UAGGGGCAGCAGAGGACCUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4723 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

 UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-4784 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-484 directly targets SLC4A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-484 miRNA Mature ID miR-484

miRNA Sequence

 UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-486 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-486 miRNA Mature ID miR-486-3p

miRNA Sequence

 CGGGGCAGCUCAGUACAGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-5010 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5010 miRNA Mature ID miR-5010-5p

miRNA Sequence

 AGGGGGAUGGCAGAGCAAAAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-509 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-509 miRNA Mature ID miR-509-5p

miRNA Sequence

 UACUGCAGACAGUGGCAAUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-5698 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

 UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-5703 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5703 miRNA Mature ID miR-5703

miRNA Sequence

 AGGAGAAGUCGGGAAGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-6132 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6132 miRNA Mature ID miR-6132

miRNA Sequence

 AGCAGGGCUGGGGAUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-615 directly targets SLC4A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-625 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

 AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-6722 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6722 miRNA Mature ID miR-6722-3p

miRNA Sequence

 UGCAGGGGUCGGGUGGGCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-6743 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6743 miRNA Mature ID miR-6743-5p

miRNA Sequence

 AAGGGGCAGGGACGGGUGGCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-6807 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-3p

miRNA Sequence

 CACUGCAUUCCUGCUUGGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-6825 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

 UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-6835 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-6836 directly targets SLC4A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6836 miRNA Mature ID miR-6836-5p

miRNA Sequence

 CGCAGGGCCCUGGCGCAGGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-6870 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

 UGGGGGAGAUGGGGGUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-7106 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

 UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-7109 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7109 miRNA Mature ID miR-7109-5p

miRNA Sequence

 CUGGGGGGAGGAGACCCUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-7111 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

 UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-765 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-765 miRNA Mature ID miR-765

miRNA Sequence

 UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-8087 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8087 miRNA Mature ID miR-8087

miRNA Sequence

 GAAGACUUCUUGGAUUACAGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-92a directly targets SLC4A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 48

 miR-944 directly targets SLC4A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-944 miRNA Mature ID miR-944

miRNA Sequence

 AAAUUAUUGUACAUCGGAUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
14 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.