Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0387 Transporter Info
Gene Name SLC4A7
Transporter Name Sodium bicarbonate cotransporter 3
Gene ID
9497
UniProt ID
Q9Y6M7
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in breast cancer [ 1 ]

Location

 TSS1500 (cg18759850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 3.45E-05; Z-score: 1.48E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in breast cancer [ 1 ]

Location

 TSS1500 (cg06798189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.50E-03; Z-score: -2.65E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A7 in breast cancer [ 1 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 9.70E-13; Z-score: -3.17E+00

Methylation in Case

 6.13E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A7 in breast cancer [ 1 ]

Location

 Body (cg02344497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 6.60E-04; Z-score: 1.08E+00

Methylation in Case

 4.82E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A7 in breast cancer [ 1 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.73E-02; Z-score: -3.40E-01

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

 TSS1500 (cg18759850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.38E-02; Z-score: -1.65E-01

Methylation in Case

 6.80E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.37E-07; Z-score: -7.09E-01

Methylation in Case

 7.06E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg03198012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.46E-18; Z-score: -6.35E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.53E-06; Z-score: -7.60E-01

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg02344497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 9.99E-05; Z-score: -1.13E+00

Methylation in Case

 4.65E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in HIV infection [ 3 ]

Location

 TSS1500 (cg18759850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.32E-04; Z-score: 7.28E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in HIV infection [ 3 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.89E-03; Z-score: 1.03E+00

Methylation in Case

 9.03E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A7 in HIV infection [ 3 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 5.60E-04; Z-score: 6.56E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in panic disorder [ 4 ]

Location

 TSS1500 (cg18759850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.16E-01 Statistic Test p-value: 1.95E-04; Z-score: -5.46E-01

Methylation in Case

 -7.89E-01 (Median) Methylation in Control -6.43E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in panic disorder [ 4 ]

Location

 TSS1500 (cg06798189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.47E-01 Statistic Test p-value: 1.10E-03; Z-score: -4.23E-01

Methylation in Case

 -7.89E-01 (Median) Methylation in Control -6.68E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A7 in panic disorder [ 4 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -7.23E-01 Statistic Test p-value: 3.35E-04; Z-score: -6.01E-01

Methylation in Case

 -7.26E-01 (Median) Methylation in Control -5.25E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A7 in panic disorder [ 4 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 3.87E-06; Z-score: -9.58E-01

Methylation in Case

 1.24E+00 (Median) Methylation in Control 1.73E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC4A7 in panic disorder [ 4 ]

Location

 Body (cg02344497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 5.12E-04; Z-score: -4.16E-01

Methylation in Case

 1.08E+00 (Median) Methylation in Control 1.26E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

 TSS200 (cg24499517)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.11E-04; Z-score: 3.35E-01

Methylation in Case

 3.91E-02 (Median) Methylation in Control 3.73E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg26637881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 6.91E-08; Z-score: 1.61E+00

Methylation in Case

 8.26E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg14576436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.93E-05; Z-score: -6.33E-01

Methylation in Case

 6.33E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg05819249)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.07E-02; Z-score: -2.23E-01

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.01E+00 Statistic Test p-value: 4.91E-29; Z-score: 4.05E+00

Methylation in Case

 7.16E-01 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg02344497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.49E-04; Z-score: -8.50E-01

Methylation in Case

 3.00E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in bladder cancer [ 7 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 1.31E-07; Z-score: -1.50E+01

Methylation in Case

 5.98E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in bladder cancer [ 7 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.89E-02; Z-score: -1.11E+00

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in lung adenocarcinoma [ 8 ]

Location

 1stExon (cg00907274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.51E-03; Z-score: -2.67E+00

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in colorectal cancer [ 9 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.45E-04; Z-score: -1.37E+00

Methylation in Case

 9.29E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC4A7 in colorectal cancer [ 9 ]

Location

 Body (cg02344497)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 9.86E-03; Z-score: 7.47E-01

Methylation in Case

 7.02E-01 (Median) Methylation in Control 6.12E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in depression [ 10 ]

Location

 Body (cg21518279)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.30E-02; Z-score: 4.33E-01

Methylation in Case

 8.47E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC4A7 in prostate cancer [ 11 ]

Location

 Body (cg10206931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.37E-02; Z-score: 1.98E+00

Methylation in Case

 8.77E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106b directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-17 directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-19b directly targets SLC4A7 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-20a directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-20b directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-25 directly targets SLC4A7 [ 14 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-25 miRNA Mature ID miR-25-3p

miRNA Sequence

 CAUUGCACUUGUCUCGGUCUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-30a directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

 UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-30b directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

 UGUAAACAUCCUACACUCAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-30c directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

 UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-30d directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

 UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-30e directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

 UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-34a directly targets SLC4A7 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

 UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-519d directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-93 directly targets SLC4A7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
4 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7 DNA Methylation Dynamics in Urological Tumors.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
13 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
14 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.