Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0390 Transporter Info
Gene Name SLC50A1
Transporter Name Sugar transporter SWEET1
Gene ID
55974
UniProt ID
Q9BRV3
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets SLC50A1 [ 1 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-331 directly targets SLC50A1 [ 2 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-331 miRNA Mature ID miR-331-3p

miRNA Sequence

 GCCCCUGGGCCUAUCCUAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
2 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.