Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0418 Transporter Info
Gene Name	SLC5A1
Transporter Name	Sodium/glucose cotransporter 1
Gene ID	6523
UniProt ID	P13866

Epigenetic Regulations of This DT (EGR)
Methylation
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in breast cancer			[ 1 ]
Location	TSS1500 (cg13818276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.12E-08; Z-score: 1.33E+00
Methylation in Case	5.13E-01 (Median)	Methylation in Control	4.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in breast cancer			[ 1 ]
Location	TSS1500 (cg09327378)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.32E-02; Z-score: 7.79E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in breast cancer			[ 1 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.98E-04; Z-score: -8.37E-01
Methylation in Case	2.69E-01 (Median)	Methylation in Control	3.29E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in breast cancer			[ 1 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.52E-04; Z-score: -9.23E-01
Methylation in Case	6.06E-01 (Median)	Methylation in Control	6.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	TSS1500 (cg13818276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.90E-08; Z-score: -1.75E+00
Methylation in Case	4.77E-01 (Median)	Methylation in Control	5.80E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	TSS1500 (cg09327378)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.62E-07; Z-score: -1.03E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg19277154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.09E-03; Z-score: -5.70E-01
Methylation in Case	3.29E-01 (Median)	Methylation in Control	3.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	TSS200 (cg26730347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 4.98E-03; Z-score: 1.14E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	3.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg16548605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 4.37E-11; Z-score: -1.94E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	6.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg24946795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.43E-10; Z-score: 1.50E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.39E-05; Z-score: -8.61E-01
Methylation in Case	7.48E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A1 in hepatocellular carcinoma			[ 2 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.46E-02; Z-score: -3.39E-01
Methylation in Case	5.59E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in HIV infection			[ 3 ]
Location	TSS1500 (cg13818276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.45E-04; Z-score: -1.44E+00
Methylation in Case	6.11E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in HIV infection			[ 3 ]
Location	TSS1500 (cg09327378)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 6.26E-04; Z-score: -9.26E-01
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in HIV infection			[ 3 ]
Location	1stExon (cg00500507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.67E-02; Z-score: 4.47E-01
Methylation in Case	5.53E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in HIV infection			[ 3 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.03E-02; Z-score: -7.54E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.19E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A1 in HIV infection			[ 3 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 7.21E-04; Z-score: -1.11E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in lung adenocarcinoma			[ 4 ]
Location	TSS1500 (cg09327378)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.08E-02; Z-score: -1.75E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in lung adenocarcinoma			[ 4 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.35E-02; Z-score: -1.51E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS1500 (cg09110274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.87E-05; Z-score: -1.19E+00
Methylation in Case	6.22E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg01971363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.03E-06; Z-score: 9.90E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in pancretic ductal adenocarcinoma			[ 5 ]
Location	3'UTR (cg04092332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.01E-02; Z-score: 3.56E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in papillary thyroid cancer			[ 6 ]
Location	TSS1500 (cg13818276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 7.36E-05; Z-score: -5.27E-01
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in papillary thyroid cancer			[ 6 ]
Location	TSS1500 (cg09327378)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.43E-04; Z-score: -9.42E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in papillary thyroid cancer			[ 6 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.61E-04; Z-score: -8.14E-01
Methylation in Case	6.78E-01 (Median)	Methylation in Control	7.22E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in papillary thyroid cancer			[ 6 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.63E-04; Z-score: -7.13E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A1 in papillary thyroid cancer			[ 6 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.63E-04; Z-score: -5.38E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Bladder cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in bladder cancer			[ 7 ]
Location	TSS200 (cg26730347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.35E+00	Statistic Test	p-value: 4.52E-05; Z-score: -5.00E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	4.22E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in bladder cancer			[ 7 ]
Location	TSS200 (cg19277154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.85E+00	Statistic Test	p-value: 6.62E-05; Z-score: -3.56E+00
Methylation in Case	2.06E-01 (Median)	Methylation in Control	3.81E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in bladder cancer			[ 7 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.26E-02; Z-score: -5.82E-01
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in bladder cancer			[ 7 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.63E+00	Statistic Test	p-value: 1.60E-02; Z-score: -1.73E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	2.26E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A1 in bladder cancer			[ 7 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 1.98E-07; Z-score: -1.23E+01
Methylation in Case	4.89E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	1stExon (cg00500507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.64E+00	Statistic Test	p-value: 2.93E-29; Z-score: -4.92E+00
Methylation in Case	4.82E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A1 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	Body (cg09672032)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.17E-02; Z-score: -3.65E-01
Methylation in Case	6.90E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A1 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.79E+00	Statistic Test	p-value: 4.61E-02; Z-score: -2.30E-01
Methylation in Case	2.46E-02 (Median)	Methylation in Control	4.40E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A1 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.15E-10; Z-score: -1.85E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in colon adenocarcinoma			[ 9 ]
Location	1stExon (cg13223402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.45E+00	Statistic Test	p-value: 7.80E-07; Z-score: 1.60E+01
Methylation in Case	3.74E-01 (Median)	Methylation in Control	5.80E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in clear cell renal cell carcinoma			[ 10 ]
Location	Body (cg14395060)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 3.06E-07; Z-score: -2.09E+00
Methylation in Case	5.98E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in prostate cancer			[ 11 ]
Location	Body (cg10718608)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 4.05E-02; Z-score: 1.73E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A1 in panic disorder			[ 12 ]
Location	3'UTR (cg20495476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.86E-03; Z-score: 2.99E-01
Methylation in Case	2.11E+00 (Median)	Methylation in Control	1.97E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC5A1 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.41E-10; Fold-change: 0.253869675; Z-score: 1.106239955
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC5A1 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00014002; Fold-change: 0.242658395; Z-score: 1.138539205
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC5A1 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.05E-06; Fold-change: -0.289427176; Z-score: -1.458106882
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC5A1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.64E-08; Fold-change: -0.285514572; Z-score: -1.600053438
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC5A1 in ovarian cancer than that in healthy individual
Studied Phenotype	Ovarian cancer [ICD-11:2C73]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.026578706; Fold-change: -0.276051372; Z-score: -1.319748764
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Uterine carcinosarcoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC5A1 in uterine carcinosarcoma than that in healthy individual
Studied Phenotype	Uterine carcinosarcoma [ICD-11:2B5F]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.047361815; Fold-change: -0.277537973; Z-score: -1.326855921
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC5A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.001954551; Fold-change: -0.316564274; Z-score: -1.317888553
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC5A1 in lung cancer than that in adjacent tissue
Studied Phenotype	Lung cancer [ICD-11:2C25]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 2.69E-06; Fold-change: -0.314685186; Z-score: -3.933670666
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-335 directly targets SLC5A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide Scan for Methylation Profiles in Breast Cancer
2	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
4	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7	DNA Methylation Dynamics in Urological Tumors.
8	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence